Advertisement

Ethanol and its Nonoxidative Metabolites Promote Acute Liver Injury by Inducing ER Stress, Adipocyte Death and Lipolysis

  • Author Footnotes
    ∗ Authors share co-first authorship.
    Seol Hee Park
    Footnotes
    ∗ Authors share co-first authorship.
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Author Footnotes
    ∗ Authors share co-first authorship.
    Wonhyo Seo
    Footnotes
    ∗ Authors share co-first authorship.
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland

    Laboratory of Hepatotoxicity, College of Pharmacy, Ewha Womans University, Seoul, Republic of Korea
    Search for articles by this author
  • Ming-Jiang Xu
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Bryan Mackowiak
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Yuhong Lin
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Yong He
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Yaojie Fu
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Seonghwan Hwang
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Seung-Jin Kim
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Yukun Guan
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Dechun Feng
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Liqing Yu
    Affiliations
    Department of Medicine, University of Maryland School of Medicine, Baltimore, Maryland
    Search for articles by this author
  • Richard Lehner
    Affiliations
    Group on Molecular and Cell Biology of Lipids, Department of Pediatrics, Department of Cell Biology, University of Alberta, Edmonton, Alberta, Canada
    Search for articles by this author
  • Suthat Liangpunsakul
    Affiliations
    Division of Gastroenterology and Hepatology, Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana

    Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana

    Roudebush Veterans Administration Medical Center, Indianapolis, Indiana
    Search for articles by this author
  • Bin Gao
    Correspondence
    Correspondence Address correspondence to: Bin Gao, MD, PhD, Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, 5625 Fishers Lane, Bethesda, Maryland 20892. fax: (xx) xxx-xxxx.
    Affiliations
    Laboratory of Liver Diseases, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
    Search for articles by this author
  • Author Footnotes
    ∗ Authors share co-first authorship.
Open AccessPublished:October 12, 2022DOI:https://doi.org/10.1016/j.jcmgh.2022.10.002

      Background & Aims

      Binge drinking in patients with metabolic syndrome accelerates the development of alcohol-associated liver disease. However, the underlying mechanisms remain elusive. We investigated if oxidative and nonoxidative alcohol metabolism pathways, diet-induced obesity, and adipose tissues influenced the development of acute liver injury in a single ethanol binge model.

      Methods and Results

      A single ethanol binge was administered to chow-fed or high-fat diet (HFD)-fed wild-type and genetically modified mice. Oral administration of a single dose of ethanol induced acute liver injury and hepatic endoplasmic reticulum (ER) stress in chow- or HFD-fed mice. Disruption of the Adh1 gene increased blood ethanol concentration and exacerbated acute ethanol-induced ER stress and liver injury in both chow-fed and HFD-fed mice, while disruption of the Aldh2 gene did not affect such hepatic injury despite high blood acetaldehyde levels. Mechanistic studies showed that alcohol, not acetaldehyde, promoted hepatic ER stress, fatty acid synthesis, and increased adipocyte death and lipolysis, contributing to acute liver injury. Increased serum fatty acid ethyl esters (FAEEs), which are formed by an enzyme-mediated esterification of ethanol with fatty acids, were detected in mice after ethanol gavage, with higher levels in Adh1 knockout mice than in wild-type mice. Deletion of the Ces1d gene in mice markedly reduced the acute ethanol-induced increase of blood FAEE levels with a slight but significant reduction of serum aminotransferase levels.

      Conclusions

      Ethanol and its nonoxidative metabolites, FAEEs, not acetaldehyde, promoted acute alcohol-induced liver injury by inducing ER stress, adipocyte death, and lipolysis.

      Graphical abstract

      Keywords

      Abbreviations used in this paper:

      ADH (alcohol dehydrogenase), ALD (alcohol-associated liver disease), ALDH2 (aldehyde dehydrogenase 2), ALT (alanine aminotransferase), AST (aspartate aminotransferase), cDNA (complementary DNA), CHOP (), CLS (crown-like structure), CYP2E1 (cytochrome p450 2E1), eIF2α (), ER (endoplasmic reticulum), FAEE (fatty acid ethyl ester), FFA (free fatty acid), GTT (glucose tolerance test), HFD (high-fat diet), HSL (hormone-sensitive lipase), IRE1α (———), ITT (insulin tolerance test), JNK (c-Jun N-terminal kinase), KO (knockout), mRNA (messenger RNA), PBA (4-phenylbutyric acid), PERK (——), PI (propidium iodide), PKA (protein kinase A), RT-qPCR (reverse-transcription quantitative polymerase chain reaction), TG (triglyceride), TUDCA (tauroursodeoxycholic acid), TUNEL (terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling), WT (wild-type)
      Binge drinking induces acute liver injury and is an important risk factor for alcohol-associated liver disease. Binge alcohol and its nonoxidative metabolites promote acute liver injury by inducing endoplasmic reticulum stress, adipocyte death, and lipolysis.
      Alcohol-associated liver disease (ALD) is a major cause of chronic liver diseases.
      • Liangpunsakul S.
      • Haber P.
      • McCaughan G.W.
      Alcoholic liver disease in Asia, Europe, and North America.
      It represents a spectrum of histopathologic changes from steatosis, steatohepatitis, cirrhosis, and hepatocellular carcinoma. The risk of ALD is associated with the quantity of alcohol consumed. Patients with alcohol-induced steatosis who continue to consume more than 400 g/wk alcohol significantly increase their risk for cirrhosis.
      • Teli M.R.
      • Day C.P.
      • Burt A.D.
      • Bennett M.K.
      • James O.F.
      Determinants of progression to cirrhosis or fibrosis in pure alcoholic fatty liver.
      In another large study of more than 13,000 patients, the risk for ALD increased considerably with drinking more than 7–13 alcoholic beverages per week in women and 14 to 27 alcoholic beverages per week in men.
      • Becker U.
      • Deis A.
      • Sorensen T.I.
      • Gronbaek M.
      • Borch-Johnsen K.
      • Muller C.F.
      • Schnohr P.
      • Jensen G.
      Prediction of risk of liver disease by alcohol intake, sex, and age: a prospective population study.
      In addition to the quantity of alcohol consumed, the pattern of drinking also is associated with the development of ALD. Binge drinking, a heavy episodic alcohol intake, is defined as consuming 5 or more drinks on an occasion for men or 4 or more drinks on an occasion for women.
      • Fillmore M.T.
      • Jude R.
      Defining "binge" drinking as five drinks per occasion or drinking to a .08% BAC: which is more sensitive to risk?.
      It is a drinking pattern associated with an increase in blood alcohol concentration above the legal limit within 2 hours.
      • Fillmore M.T.
      • Jude R.
      Defining "binge" drinking as five drinks per occasion or drinking to a .08% BAC: which is more sensitive to risk?.
      Binge drinking is thought to be an important risk factor for ALD observed in millennials
      • Tapper E.B.
      • Parikh N.D.
      Mortality due to cirrhosis and liver cancer in the United States, 1999-2016: observational study.
      ,
      • Wong T.
      • Dang K.
      • Ladhani S.
      • Singal A.K.
      • Wong R.J.
      Prevalence of alcoholic fatty liver disease among adults in the United States, 2001-2016.
      and patients with metabolic syndrome.
      • Ventura-Cots M.
      • Watts A.E.
      • Bataller R.
      Binge drinking as a risk factor for advanced alcoholic liver disease.
      ,
      • Aberg F.
      • Helenius-Hietala J.
      • Puukka P.
      • Jula A.
      Binge drinking and the risk of liver events: a population-based cohort study.
      However, the underlying mechanisms of binge drinking–associated ALD remain elusive.
      Once ingested, alcohol is metabolized, primarily in the liver, by oxidative and nonoxidative pathways.
      • Jiang Y.
      • Zhang T.
      • Kusumanchi P.
      • Han S.
      • Yang Z.
      • Liangpunsakul S.
      Alcohol metabolizing enzymes, microsomal ethanol oxidizing system, cytochrome P450 2E1, catalase, and aldehyde dehydrogenase in alcohol-associated liver disease.
      More than 90% of ingested alcohol is converted into acetaldehyde by oxidative enzymes, alcohol dehydrogenase (ADH), cytochrome P450 2E1 (CYP2E1), and catalase.
      • Jiang Y.
      • Zhang T.
      • Kusumanchi P.
      • Han S.
      • Yang Z.
      • Liangpunsakul S.
      Alcohol metabolizing enzymes, microsomal ethanol oxidizing system, cytochrome P450 2E1, catalase, and aldehyde dehydrogenase in alcohol-associated liver disease.
      Many adverse effects of ethanol among chronic drinkers are mediated by its byproduct, acetaldehyde.
      • Setshedi M.
      • Wands J.R.
      • Monte S.M.
      Acetaldehyde adducts in alcoholic liver disease.
      Acetaldehyde is metabolized further into acetate by mitochondrial aldehyde dehydrogenase 2 (ALDH2) in the liver. Interestingly, our recent studies suggest that liver ALDH2 is responsible for less than 50% of blood acetaldehyde clearance.
      • Guillot A.
      • Ren T.
      • Jourdan T.
      • Pawlosky R.J.
      • Han E.
      • Kim S.J.
      • Zhang L.
      • Koob G.F.
      • Gao B.
      Targeting liver aldehyde dehydrogenase-2 prevents heavy but not moderate alcohol drinking.
      In addition, a nonoxidative pathway to metabolize alcohol is mediated by the generation of lipophilic fatty acid ethyl esters (FAEEs), a combination of alcohol with free fatty acids.
      • Huang W.
      • Booth D.M.
      • Cane M.C.
      • Chvanov M.
      • Javed M.A.
      • Elliott V.L.
      • Armstrong J.A.
      • Dingsdale H.
      • Cash N.
      • Li Y.
      • Greenhalf W.
      • Mukherjee R.
      • Kaphalia B.S.
      • Jaffar M.
      • Petersen O.H.
      • Tepikin A.V.
      • Sutton R.
      • Criddle D.N.
      Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
      The generation of FAEEs is mediated by tissue-specific FAEE synthase enzymes, FAEE carboxylesterase (encoded by Ces1d in murine and CES1 in human beings) in the liver, and Cel in the pancreas.
      • Lange L.G.
      Nonoxidative ethanol metabolism: formation of fatty acid ethyl esters by cholesterol esterase.
      • Tsujita T.
      • Okuda H.
      Fatty acid ethyl ester synthase in rat adipose tissue and its relationship to carboxylesterase.
      • Holmes R.S.
      • Wright M.W.
      • Laulederkind S.J.
      • Cox L.A.
      • Hosokawa M.
      • Imai T.
      • Ishibashi S.
      • Lehner R.
      • Miyazaki M.
      • Perkins E.J.
      • Potter P.M.
      • Redinbo M.R.
      • Robert J.
      • Satoh T.
      • Yamashita T.
      • Yan B.
      • Yokoi T.
      • Zechner R.
      • Maltais L.J.
      Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.
      FAEEs accumulate in tissues after acute alcohol intoxication, causing organ inflammation and injury.
      • Huang W.
      • Booth D.M.
      • Cane M.C.
      • Chvanov M.
      • Javed M.A.
      • Elliott V.L.
      • Armstrong J.A.
      • Dingsdale H.
      • Cash N.
      • Li Y.
      • Greenhalf W.
      • Mukherjee R.
      • Kaphalia B.S.
      • Jaffar M.
      • Petersen O.H.
      • Tepikin A.V.
      • Sutton R.
      • Criddle D.N.
      Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
      The implications of binge drinking on oxidative and nonoxidative pathways in association with liver injury remain obscure.
      The pathogenesis of ALD is complex and interorgan crosstalk between the liver and other tissues contributes to the progression of ALD.
      • Gao B.
      • Ahmad M.F.
      • Nagy L.E.
      • Tsukamoto H.
      Inflammatory pathways in alcoholic steatohepatitis.
      Interorgan crosstalk leads to inflammation, metabolic alternations, and cell death in ALD.
      • Gao B.
      • Ahmad M.F.
      • Nagy L.E.
      • Tsukamoto H.
      Inflammatory pathways in alcoholic steatohepatitis.
      Adipose tissue is an important organ in regulating lipid homeostasis.
      • Liangpunsakul S.
      • Chalasani N.
      Lipid mediators of liver injury in nonalcoholic fatty liver disease.
      Chronic alcohol consumption markedly increases adipocyte death
      • Sebastian B.M.
      • Roychowdhury S.
      • Tang H.
      • Hillian A.D.
      • Feldstein A.E.
      • Stahl G.L.
      • Takahashi K.
      • Nagy L.E.
      Identification of a cytochrome P4502E1/Bid/C1q-dependent axis mediating inflammation in adipose tissue after chronic ethanol feeding to mice.
      and lipolytic activity in murine adipose tissue.
      • Zhong W.
      • Zhao Y.
      • Tang Y.
      • Wei X.
      • Shi X.
      • Sun W.
      • Sun X.
      • Yin X.
      • Sun X.
      • Kim S.
      • McClain C.J.
      • Zhang X.
      • Zhou Z.
      Chronic alcohol exposure stimulates adipose tissue lipolysis in mice: role of reverse triglyceride transport in the pathogenesis of alcoholic steatosis.
      ,
      • Mathur M.
      • Yeh Y.T.
      • Arya R.K.
      • Jiang L.
      • Pornour M.
      • Chen W.
      • Ma Y.
      • Gao B.
      • He L.
      • Ying Z.
      • Xue B.
      • Shi H.
      • Choi Y.
      • Yu L.
      Adipose lipolysis is important for ethanol to induce fatty liver in the National Institute on Alcohol Abuse and Alcoholism murine model of chronic and binge ethanol feeding.
      An increase in adipose tissue lipolysis causes the release of nonesterified free fatty acids, providing an extrahepatic source of free fatty acids for accumulation in hepatocytes, causing hepatic steatosis by the esterification process to triglycerides.
      • Wei X.
      • Shi X.
      • Zhong W.
      • Zhao Y.
      • Tang Y.
      • Sun W.
      • Yin X.
      • Bogdanov B.
      • Kim S.
      • McClain C.
      • Zhou Z.
      • Zhang X.
      Chronic alcohol exposure disturbs lipid homeostasis at the adipose tissue-liver axis in mice: analysis of triacylglycerols using high-resolution mass spectrometry in combination with in vivo metabolite deuterium labeling.
      The role of adipose tissue in binge alcohol consumption and liver injury remains elusive.
      The development of the chronic-plus-binge ethanol model has led to the discovery of multiple pathways in ALD pathogenesis.
      • Gao B.
      • Xu M.J.
      • Bertola A.
      • Wang H.
      • Zhou Z.
      • Liangpunsakul S.
      Animal models of alcoholic liver disease: pathogenesis and clinical relevance.
      • Sanz-Garcia C.
      • Poulsen K.L.
      • Bellos D.
      • Wang H.
      • McMullen M.R.
      • Li X.
      • Chattopadhyay S.
      • Sen G.
      • Nagy L.E.
      The non-transcriptional activity of IRF3 modulates hepatic immune cell populations in acute-on-chronic ethanol administration in mice.
      • Wang L.
      • You H.M.
      • Meng H.W.
      • Pan X.Y.
      • Chen X.
      • Bi Y.H.
      • Zhang Y.F.
      • Li J.J.
      • Yin N.N.
      • Zhang Z.W.
      • Huang C.
      • Li J.
      STING-mediated inflammation contributes to Gao binge ethanol feeding model.
      • Wang S.
      • Ni H.M.
      • Chao X.
      • Ma X.
      • Kolodecik T.
      • De Lisle R.
      • Ballabio A.
      • Pacher P.
      • Ding W.X.
      Critical role of TFEB-mediated lysosomal biogenesis in alcohol-induced pancreatitis in mice and humans.
      • Ma J.
      • Guillot A.
      • Yang Z.
      • Mackowiak B.
      • Hwang S.
      • Park O.
      • Peiffer B.J.
      • Ahmadi A.R.
      • Melo L.
      • Kusumanchi P.
      • Huda N.
      • Saxena R.
      • He Y.
      • Guan Y.
      • Feng D.
      • Sancho-Bru P.
      • Zang M.
      • Cameron A.M.
      • Bataller R.
      • Tacke F.
      • Sun Z.
      • Liangpunsakul S.
      • Gao B.
      Distinct histopathological phenotypes of severe alcoholic hepatitis suggest different mechanisms driving liver injury and failure.
      However, the molecular mechanisms underlying binge ethanol–induced liver injury have not been investigated carefully. To address these mechanisms, we used a single ethanol binge model in several genetically modified mouse models to identify the pathways linking binge drinking, obesity, and acute liver injury. There is a challenge in developing a preclinical model for binge alcohol consumption in rodents.
      • Jeanblanc J.
      • Rolland B.
      • Gierski F.
      • Martinetti M.P.
      • Naassila M.
      Animal models of binge drinking, current challenges to improve face validity.
      The amount of alcohol consumed in human beings during a binge episode, which may lead to liver injury, is approximately 0.8–1 g/kg in a 70-kg subject.
      • Fillmore M.T.
      • Jude R.
      Defining "binge" drinking as five drinks per occasion or drinking to a .08% BAC: which is more sensitive to risk?.
      In mice, ethanol metabolism and clearance are approximately 5.5-fold faster than that in human beings.
      • Jeanblanc J.
      • Rolland B.
      • Gierski F.
      • Martinetti M.P.
      • Naassila M.
      Animal models of binge drinking, current challenges to improve face validity.
      We therefore carefully selected the quantity of alcohol being administered in our mouse model at 5–7 g/kg. By using this model, here we investigated the role of a single ethanol binge and acute liver injury by focusing on the following objectives. First, we examined if oxidative and nonoxidative alcohol metabolism pathways influence the development of acute liver injury. Second, we explored the implications of a single ethanol binge and diet-induced obesity on acute liver injury. Third, we determined the role of the liver and adipose tissue crosstalk in the pathogenesis of liver injury after a single ethanol binge.

      Results

      A Single Ethanol Binge Induces Acute Liver Injury in Mice via the Induction of Endoplasmic Reticulum Stress

      A single ethanol binge via oral gavage to C57BL/6N mice induced liver injury in a dose-dependent manner, from 5 to 7 g/kg of ethanol (Figure 1A). The highest peak of serum alanine aminotransferase (ALT) (∼220 IU/L) and aspartate aminotransferase (AST) (∼400 IU/L) was observed in mice receiving 7 g/kg of ethanol approximately 9 hours after administration (Figure 1A). We found a positive correlation between body weight and serum ALT levels at 9 hours after a single ethanol binge (7 g/kg) in both C57BL/6N and C57BL/6J mice (Figure 1B). However, the increase of serum ALT levels was higher in C57BL/6N mice than in C57BL/6J mice after a single binge (7 g/kg), suggesting that C57BL/6N mice were more sensitive to acute alcoholic injury than C57BL/6J mice (Figure 1B). In addition, our data showed that male mice were more susceptible to acute alcohol-induced liver injury than female mice (serum ALT level, ∼220 IU/L in male mice vs ∼160 IU/L in female mice). Alcohol-induced liver injury also was observed in BALB/c mice, again in a dose-dependent manner with higher serum AST and ALT levels in 7-g/kg ethanol–treated than in 5-g/kg ethanol–treated BALB/c mice (ALT level, ∼250 IU/L; AST level, ∼340 IU/L in the 7-g/kg binge group vs ALT level, ∼125 IU/L; AST level, ∼180 IU/L in the 5-g/kg binge group).
      Figure thumbnail gr1
      Figure 1Binge alcohol induces acute liver injury by activating ER stress. C57BL/6N mice (age, 8–10 wk; male) were acutely gavaged with different doses of ethanol (5-7 g/kg). After ethanol gavage, mice were killed at different time points. (A) Serum ALT and AST levels were assessed. (B) Serum ALT levels in C57BL/6N and C57BL/6J mice were measured after an acute ethanol gavage (7 g/kg ethanol). Liver tissues were subjected to (C) Western blot and (D) RT-qPCR analysis. (E) Serum ALT levels were determined after a single alcohol gavage (7 g/kg) was administered to WT and Chop-/- mice (9 hours after alcohol gavage). (F) C57BL/6N mice were administered via intraperitoneal injection JNK inhibitor II or ER stress inhibitors, PBA and TUDCA, 15 minutes before 7-g/kg ethanol gavage. Serum ALT levels were measured. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .01, and ∗∗∗P < .001 vs the corresponding controls. ctrl, control; MW, molecular weight.
      Activation of the endoplasmic reticulum (ER) stress pathway has been implicated in ethanol-induced liver injury after chronic ethanol feeding or chronic-plus-binge ethanol feeding.
      • Cai Y.
      • Xu M.J.
      • Koritzinsky E.H.
      • Zhou Z.
      • Wang W.
      • Cao H.
      • Yuen P.S.
      • Ross R.A.
      • Star R.A.
      • Liangpunsakul S.
      • Gao B.
      Mitochondrial DNA-enriched microparticles promote acute-on-chronic alcoholic neutrophilia and hepatotoxicity.
      We next asked if the pathway related to liver injury after a single ethanol binge also is attributed to ER stress. As illustrated in Figure 1C, a single ethanol binge (7 g/kg) rapidly up-regulated the expression of several ER stress-related proteins, notably phosphorylated PERK, phosphorylated eIF2α, IRE1α, phosphorylated c-Jun N-terminal kinase (JNK), CHOP, and BiP, with the peak expression approximately 3–6 hours after binge. Along with the induction of ER stress-related proteins, hepatic expressions of pro-apoptotic protein such as BAD (Figure 1C), and messenger RNA (mRNA) expressions of Gadd34, Bak, Bim, Ero1b, and Dr5 were increased markedly after a single ethanol binge (Figure 1D).
      CHOP is induced by ER stress and mediates cellular apoptosis.
      • Hu H.
      • Tian M.
      • Ding C.
      • Yu S.
      The C/EBP homologous protein (CHOP) transcription factor functions in endoplasmic reticulum stress-induced apoptosis and microbial infection.
      To confirm that the ER stress pathway is crucial in the pathogenesis of liver injury in a single ethanol binge model, we used a loss-of-function approach using Chop-/- mice and the ER stress inhibitors 4-phenylbutyric acid (PBA) and tauroursodeoxycholic acid (TUDCA). The serum ALT levels in Chop-/- mice receiving a single ethanol binge at 7 g/kg were markedly lower than those in wild-type (WT) controls (Figure 1E). In addition, the administration of ER stress inhibitors (PBA and TUDCA) but not a JNK inhibitor significantly attenuated serum ALT levels in mice receiving a single ethanol binge (Figure 1F). Taken together, these data suggest that a single ethanol binge induces hepatocyte injury via the induction of ER stress.

      Disruption of the Oxidative Metabolizing Enzyme, Adh1, Exacerbates Acute Ethanol-Induced Liver Injury in Chow- and High-Fat Diet–Fed Mice

      To examine whether ethanol or its oxidative metabolites play an important role in alcohol-induced liver injury in our single ethanol binge model, we performed the experiments in mice lacking Adh1, a key oxidizing enzyme converting ethanol to acetaldehyde. As expected, blood ethanol concentrations were much higher in Adh1-/- mice than in WT mice, notably at 6 and 9 hours after an ethanol binge, whereas the level of serum acetaldehyde was comparable in Adh1-/- and WT mice (Figure 2A). Interestingly, a single ethanol binge induced higher serum ALT levels in Adh1-/- mice than those in WT mice (Figure 2A). In agreement with this finding, hepatocyte death, hepatic ER stress-related proteins and genes were higher in Adh1-/- mice than those in WT mice after a single ethanol binge (Figure 2B–D).
      Figure thumbnail gr2
      Figure 2Deletion of the Adh1 gene exacerbates acute alcoholic liver injury and ER stress–mediated hepatocyte death. Chow-fed WT and Adh1-/- mice were given a single ethanol binge. Mice were killed at different time points postgavage. (A) Serum ethanol, acetaldehyde, and ALT levels were evaluated. (B) Liver tissue sections were subjected to TUNEL staining. Representative images are shown. (C) Western blot analyses were performed on liver tissue lysates, and the density of bands was quantified. (D) Liver tissues were subjected to RT-qPCR analysis. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .01 vs the corresponding controls. ctrl, control; MW, molecular weight.
      In addition to ADH, ethanol can be oxidized by a microsomal ethanol oxidizing system, CYP2E1, and peroxisomal catalase.
      • Jiang Y.
      • Zhang T.
      • Kusumanchi P.
      • Han S.
      • Yang Z.
      • Liangpunsakul S.
      Alcohol metabolizing enzymes, microsomal ethanol oxidizing system, cytochrome P450 2E1, catalase, and aldehyde dehydrogenase in alcohol-associated liver disease.
      We therefore performed the experiments to determine the potential role of CYP2E1 and catalase in ALD after a single ethanol binge. There was no difference in the level of serum ALT in WT and Cyp2e1-/- mice receiving a single ethanol binge. Treatment with the catalase inhibitor 3-amino-1,2,4-triazole or salicylic acid slightly, but not significantly, increased serum ALT levels in ethanol-treated mice (data not shown). Moreover, binge alcohol intake increased hepatic MDA levels, however, significant differences between WT and Adh1-/- mice were not observed in MDA, Sod1, Sod2, catalase, or several inflammatory markers (data not shown). Collectively, these data suggest that among alcohol-metabolizing enzymes, ADH1, but not CYP2E1 and catalase, plays an important role in acute liver injury in a single ethanol binge model via the inhibition of ER stress, but not oxidative stress.
      As previously stated, binge drinking, in combination with metabolic syndrome or obesity, causes a synergistic effect for ALD.
      • Ventura-Cots M.
      • Watts A.E.
      • Bataller R.
      Binge drinking as a risk factor for advanced alcoholic liver disease.
      ,
      • Aberg F.
      • Helenius-Hietala J.
      • Puukka P.
      • Jula A.
      Binge drinking and the risk of liver events: a population-based cohort study.
      Next, we further explored whether the deficiency of Adh1 is also more susceptible to acute alcoholic liver injury under a high-fat diet (HFD)-mediated obese condition. WT and Adh1-/- mice fed with a HFD for 3 months without alcohol gavage had similar body weight gain and glucose homeostasis, as measured by the glucose tolerance test (GTT) and the insulin tolerance test (ITT) (Figure 3A). Because oral administration of 6 or 7 g/kg ethanol caused high mortality in HFD-fed mice, we only used 5 g/kg ethanol gavage in HFD-fed mice in the following experiments. As illustrated in Figure 3B, HFD-fed Adh1-/- mice receiving a single ethanol binge had higher levels of blood ethanol concentrations and serum ALT compared with HFD-fed WT mice. However, blood acetaldehyde levels were comparable between WT and Adh1-/- mice after a single ethanol binge (Figure 3B). Furthermore, HFD-plus-binge ethanol-fed Adh1-/- mice had greater liver fibrogenic response and hepatocyte death as shown by H&E, Sirius Red, and terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining, compared with that of WT mice (Figure 3C), and higher levels of ER stress and fibrotic genes as shown by reverse-transcription quantitative polymerase chain reaction (RT-qPCR) analyses (Figure 3D). Finally, we also performed in vitro experiments in primary hepatocytes isolated from WT and Adh1-/- mice treated with palmitic acid (200 μmol/L) in the presence and absence of ethanol (100 mmol/L). We found that mRNA expression of Chop and Bim was significantly higher in Adh1-deficient hepatocytes treated with both palmitic acid and ethanol when compared with those treated with either palmitic acid or ethanol (Figure 3E).
      Figure thumbnail gr3
      Figure 3HFD-fed Adh1-/- mice are more susceptible to acute alcoholic liver injury and ER stress. (A) Adh1-/- and WT mice were fed a HFD for 3 months without ethanol binge. Body weight change was evaluated. A GTT (0.75 g/kg glucose via intraperitoneal injection) and an ITT (1.5 IU/kg insulin via intraperitoneal injection) were performed. (B–D) Adh1-/- and WT mice were fed a HFD for 3 months followed by receiving a single alcohol gavage (5 g/kg) or isocaloric maltose. (B) Mice were killed 9 hours after acute alcohol administration. Serum ethanol, acetaldehyde, and ALT levels were measured. (C) H&E, Sirius Red, and TUNEL staining were performed on liver tissue sections. (D) Liver tissue lysates were subjected to RT-qPCR analysis. (E) Freshly isolated hepatocytes (WT and Adh1-deficient hepatocytes) were treated with palmitic acid (200 μmol/L) and ethanol (100 mmol/L) for 12 hours, followed by performing RT-qPCR. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .01 vs the corresponding controls. PA, _____; Veh, vehicle; 3M, _______.

      Depletion of the Oxidative Metalizing Enzyme Aldh2 Does Not Exaggerate Acute Alcohol-Induced Liver Injury in Chow-Fed and HFD-Fed Mice

      Once generated from the metabolism of alcohol by oxidative enzymes, acetaldehyde subsequently is converted to acetate by ALDH2. To evaluate the role of acetaldehyde in a single binge ethanol model, we performed the experiments using Aldh2-/- mice. Administration of ethanol at 7 g/kg caused significantly high mortality in Aldh2-/- mice; we therefore used 6 g/kg ethanol in Aldh2-/- mice and their controls in the subsequent experiments. After ethanol gavage, blood ethanol concentrations were slightly but significantly higher in Aldh2-/- than those in WT mice, whereas much higher blood acetaldehyde levels were observed in Aldh2-/- mice than in WT mice after ethanol gavage (Figure 4A). Despite higher levels of acetaldehyde, the serum ALT levels in Aldh2-/- and WT mice were comparable, suggesting that high blood acetaldehyde does not play a significant role in alcohol-induced liver injury in our model (Figure 4A). Hepatic expression of several ER stress-related genes, except for Gadd34 (DNA damage-inducible gene), also was similar between both groups after ethanol gavage (Figure 4B). Protein expressions of CYP2E1 and ER stress-related proteins CHOP and BIM, also were similar between both groups after a single ethanol gavage (Figure 4C).
      Figure thumbnail gr4
      Figure 4Deletion of the Aldh2 gene does not affect acute alcoholic liver injury. (A) Aldh2-/- and WT mice were subjected to ethanol gavage (4 g/kg of ethanol) and killed 3 hours after gavage. Blood ethanol and acetaldehyde levels were measured. In addition, Aldh2-/- and WT mice were subjected to ethanol gavage (various doses of ethanol) and killed 9 hours postgavage, followed by measuring serum ALT levels. (B and C) Aldh2-/- and WT mice were subjected to ethanol gavage (6 g/kg of ethanol) and killed 9 hours after gavage. RT-qPCR and Western blot analyses were performed on liver tissue lysates. Data are expressed as the means ± SEM. ∗∗P < .01 vs the corresponding controls. MW, molecular weight.
      We also explored the involvement of ALDH2 on liver injury induced by ethanol binge in combination with the HFD feeding. Aldh2-/- mice had similar body weight gains and glucose homeostasis, as measured by the GTT and ITT when compared with corresponding WT groups after 3 months of HFD feeding without ethanol gavage (Figure 5A). After ethanol gavage (5 g/kg), HFD-fed Aldh2-/- mice had much higher levels of blood acetaldehyde levels compared with WT mice, but both groups had similar serum ALT levels (Figure 5B), hepatocyte death, hepatic collagen deposition, and hepatic expression of ER stress and fibrotic genes (Figure 5C).
      Figure thumbnail gr5
      Figure 5Deletion of the Aldh2 gene does not exacerbate acute alcoholic liver injury, obesity, and insulin resistance. (A) Aldh2-/- and WT mice were fed a HFD for 3 months without ethanol gavage. Body weight change, GTT (0.75 g/kg glucose via intraperitoneal injection), and ITT (1.5 IU/kg insulin via intraperitoneal injection) were evaluated. (B and C) Aldh2-/- and WT mice were fed a HFD for 3 months followed by a single dose of ethanol (5 g/kg) or isocaloric maltose, and the mice were killed 9 hours later. (B) Serum acetaldehyde and ALT levels were assessed. (C) Liver tissue lysates were subjected to RT-qPCR analysis. Data are expressed as the means ± SEM. ∗∗P < .01 vs the corresponding controls. 3M, ______.

      Administration of Ethanol, but Not Acetaldehyde, Induces Liver Injury by Promoting ER Stress and Hepatocyte Death

      To further determine whether ethanol or acetaldehyde induces acute liver injury in a single binge ethanol model, ethanol or acetaldehyde was administered via an intraperitoneal route to WT mice. As illustrated in Figure 6A, the intraperitoneal administration of ethanol (6 g/kg) rapidly increased blood ethanol levels (left panel) and serum ALT levels (right panel). Hepatic expression of ER stress-related genes (Chop and Xbp-1), cell death–associated genes (Bim, Bax, and Bak), and neutrophil infiltration–related genes (Ly6g, Lcn2, and Cxcl1) were up-regulated with the peak induction at 9 hours after administration (Figure 6B). Next, we also administered ethanol intraperitoneally to WT and Adh1-/- mice and killed them 9 hours after administration. As illustrated in Figure 6C, serum ALT and ethanol levels, but not acetaldehyde, were higher in Adh1-/- mice compared with corresponding WT mice. Concomitantly, hepatic expressions of Chop, Xbp-1, and Bim were greater in Adh1-/- mice than in WT mice (Figure 6C).
      Figure thumbnail gr6
      Figure 6Intraperitoneal administration of ethanol, not acetaldehyde, induces acute liver injury and hepatic ER stress. (A–C) C57BL/6N mice were intraperitoneally administered 6 g/kg ethanol and were killed 9 hours postinjection. (A) Serum samples of ethanol and ALT levels were measured. (B) Liver tissue lysates at different time points were subjected to RT-qPCR analyses. (C) Serum and liver tissues from WT and Adh1-/- mice were tested for ALT, ethanol, and acetaldehyde levels, as well as hepatic mRNA expression. (D) C57BL/6N mice were injected intraperitoneally with acetaldehyde (50 mg/kg) and killed 9 hours later. Serum acetaldehyde and ALT levels were determined. Data are expressed as the means ± SEM. ∗P <.05, ∗∗P < .01, and ∗∗∗P < .001 vs the corresponding controls. IP, intraperitoneal.
      Next, we also evaluated the involvement of acetaldehyde in acute liver injury by intraperitoneal injection of acetaldehyde (50 mg/kg). As illustrated in Figure 6D, injection of acetaldehyde rapidly increased blood acetaldehyde levels with the peak at 15 minutes after injection; its level gradually decreased to very low levels at 3 hours after injection, which is probably because acetaldehyde is short-lived and metabolized rapidly in the liver. Administration of acetaldehyde slightly increased serum ALT levels for up to 1 hour, but it did not reach a statistical difference, suggesting that acetaldehyde does not attribute to acute liver injury (Figure 6D).

      Acute Alcohol Gavage Increases Hepatic Expression of Fatty Acid Synthesis–Related Genes, Increases Serum Free Fatty Acids, and Increases Adipose Tissue Lipolysis

      To understand molecular mechanisms of acute liver injury after a single ethanol binge, we subjected liver tissues for microarray analyses and analyzed lipid metabolism–associated gene expression profiles. A large number of dysregulated genes was observed in the livers of mice receiving 5 or 7 g/kg ethanol gavage compared with those from control mice, with the most alternations from the 7 g/kg ethanol gavage group (Figure 7A). The genes related to fatty acid metabolism were the most altered in mice receiving 7 g/kg ethanol gavage compared with controls and those receiving a 5 g/kg ethanol gavage (Figure 7B and C). In more details, oral administration of 7 g/kg ethanol markedly up-regulated hepatic expression of de novo lipogenesis genes (Acaca, Fasn, and Cyp51), but attenuated hepatic expression of the fatty acid oxidation pathway (Pparα, Fgf21, and Cyp4a10), with limited impact on hepatic triglyceride (TG) synthesis (Dgat2 and Ldlr) (Figure 8A). Interestingly, lipid droplet dynamics–related genes (Apoe and ApoB) also were altered with acute alcohol gavage. In addition, the administration of 7 g/kg alcohol was highly associated with proinflammatory responses and inversely associated with fatty acid oxidation (Figure 8A).
      Figure thumbnail gr7
      Figure 7Binge ethanol causes increased lipid synthesis and a decrease in β-oxidation. (A) Z-score hierarchical clustering heat map visualization changes are shown. The colors reflect scaled expression levels, with blue representing low expression and red representing high expression. (B) Predicted up-regulation/down-regulation of top lipid metabolism functions using biofunctional analysis (control vs 1B7g). (C) Ingenuity pathway analysis (IPA) was used to show the top 20 predicted pathways that differed significantly from ethanol binge 5 g/kg vs ethanol binge 7 g/kg. ChREBP, _______.
      Figure thumbnail gr8
      Figure 8Binge ethanol increases hepatic FFAs and increases adipose tissue lipolysis. Mice were subjected to a single ethanol binge (5 or 7 g/kg) or isocaloric maltose and were killed 9 hours after alcohol gavage. (A) Liver tissues were subjected to microarray analyses. The heatmap and ingenuity pathway analysis (IPA) analyses for liver mRNA expression are shown. (B) Sera were collected for FFA measurement. Liver FFA and TG levels were measured. (C) Gas chromatography–mass spectrometry was used to perform specific FFA studies on liver tissues. Hepatic FASN and SCD1 proteins were analyzed using Western blot. (D) Collected white adipose tissues was analyzed using Western blot. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .01 vs the corresponding controls. ctrl, control.
      To further explore how 7 g/kg ethanol gavage induces acute liver injury and how fatty acid metabolism is involved, we measured serum and hepatic free fatty acids (FFAs) and hepatic TG levels. As illustrated in Figure 8B, oral administration of 7 g/kg ethanol markedly increased serum and hepatic FFAs as well as hepatic triglyceride levels. In addition, hepatic levels of several FFAs including palmitic acid, oleic acid, and linoleic acid were increased drastically after oral alcohol administration (Figure 8C). Hepatic expressions of FASN and SCD1 proteins, which play an important role in fatty acid synthesis, were highly up-regulated after acute alcohol gavage (Figure 8C).
      Because serum levels of FFAs were highly increased after a single ethanol binge, and adipose lipolysis has been shown to promote steatosis,
      • Mathur M.
      • Yeh Y.T.
      • Arya R.K.
      • Jiang L.
      • Pornour M.
      • Chen W.
      • Ma Y.
      • Gao B.
      • He L.
      • Ying Z.
      • Xue B.
      • Shi H.
      • Choi Y.
      • Yu L.
      Adipose lipolysis is important for ethanol to induce fatty liver in the National Institute on Alcohol Abuse and Alcoholism murine model of chronic and binge ethanol feeding.
      we wondered whether adipose tissue is the source of circulating FFAs through the lipolytic process in the adipose tissues. To test this hypothesis, we performed Western blot analyses of lipolysis-related proteins. Our data show that oral ethanol administration increased the expression of lipolysis proteins such as phosphorylated protein kinase A (PKA), phosphorylated hormone-sensitive lipase (HSL), and adipose triglyceride lipase in adipose tissues, suggesting acute alcohol gavage–induced adipose tissue lipolysis (Figure 8D).

      Acute Alcohol Gavage Causes Adipocyte Death and ER Stress in Adipose Tissues, Which Is Enhanced in Adh1-/- but Not in Aldh2-/- Mice

      We previously showed that adipocyte death triggers lipolysis.
      • Kim S.J.
      • Feng D.
      • Guillot A.
      • Dai S.
      • Liu F.
      • Hwang S.
      • Parker R.
      • Seo W.
      • He Y.
      • Godlewski G.
      • Jeong W.I.
      • Lin Y.
      • Qin X.
      • Kunos G.
      • Gao B.
      Adipocyte death preferentially induces liver injury and inflammation through the activation of chemokine (C-C Motif) receptor 2-positive macrophages and lipolysis.
      Thus, we speculated whether acute ethanol-induced lipolysis was the result of induction of adipocyte death. To answer this question, we measured ethanol and acetaldehyde concentrations in adipose and liver tissues after ethanol gavage. As illustrated in Figure 9A, total ethanol concentrations were comparable between the liver and adipose tissues after ethanol gavage except for the 1-hour time point in which ethanol concentrations were higher in the liver than in adipose tissues, where the levels of acetaldehyde were much lower in adipose tissues than in liver tissues after a single binge (Figure 9A).
      Figure thumbnail gr9
      Figure 9Binge ethanol induces adipocyte death and ER stress in adipose tissues with greater induction in Adh1-/- mice than in WT mice. (A–C) C57BL/6N mice were treated with a single ethanol binge (7 g/kg) or isocaloric maltose and killed at various time points after alcohol gavage. Liver and white adipose tissues were collected for the following analyses. (A) Ethanol and acetaldehyde concentrations in liver and white adipose tissues (epididymal fat and subcutaneous fat) were determined. (B) Representative staining images of H&E, TUNEL, and F4/80 staining of epididymal fat tissues 9 hours after ethanol gavage. (C) Caspase 3/7 activity assays and RT-qPCR analysis of ER stress and lipolysis-associated genes in epididymal fat tissues 9 hours after ethanol gavage were performed. (D–F) Adh1-/- and WT mice were subjected to 7 g/kg alcohol gavage and killed 9 hours after alcohol administration. (D) H&E and TUNEL staining were performed on sections of white adipose tissue. (E) Ethanol, acetaldehyde, and caspase 3/7 activity were measured in white adipose tissues. Serum FFA levels were assessed. (F) Adipose tissues were subjected to RT-qPCR analyses. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .01 vs the corresponding controls. ctrl, control.
      Next, we examined adipose tissue histology after a single ethanol gavage. Our preliminary data showed that the number of crown-like structures (CLSs) was higher in epididymal fat than in subcutaneous fat after alcohol gavage (both single binge and 3M HFD-plus-binge). In addition, we did not observe significant morphologic changes/gene expression of brown adipose tissues in the single binge model and the HFD-plus-binge ethanol feeding model compared with their corresponding controls (data not shown). Thus, we focused on epididymal fat in this study and found that epididymal adipose tissues had an increase in CLS after a single ethanol binge compared with the control group, and the number of TUNEL+ and F4/80+ cells was increased mostly around the CLS after ethanol gavage (Figure 9B), showing a typical pattern of adipocyte death formed by the accumulation of macrophages around the dead/injured adipocytes. Caspase 3/7 activity was increased in the binge alcohol gavage group compared with the control group (Figure 9C). Furthermore, RT-qPCR data showed that the expression of several ER stress–related genes in adipose tissues was up-regulated after acute alcohol gavage (Figure 9C).
      We further explored acute alcohol-induced adipocyte death and lipolysis in Adh1-/- mice. Figure 9D shows that adipose tissues from Adh1-/- mice had a greater number of the CLS and TUNEL+ cells. As expected, Adh1-/- mice had higher levels of ethanol and caspase 3/7 activity, but lower levels of acetaldehyde than WT mice after a single ethanol gavage (Figure 9E). The levels of serum FFA, and the expression of ER stress–, cell death–, and lipolysis-related genes in adipose tissues were greater in Adh1-/- mice compared with WT mice after ethanol gavage (Figure 9E and F).
      In addition, binge alcohol gavage (6 g/kg) was given to Aldh2-/- and WT mice. After the binge alcohol gavage, acetaldehyde concentration in white adipose tissues was much higher in Aldh2-/- mice than that in WT mice, as we expected (Figure 10A). Interestingly, ethanol levels in adipose tissues were also slightly higher in Aldh2-/- mice than in WT mice (Figure 10A). Despite higher levels of acetaldehyde, Aldh2-/- mice showed similar CLS formation, TUNEL+ cells, and caspase 3/7 activity (Figure 10B and C). RT-qPCR analyses revealed the expression of several ER stress–related genes in adipose tissues was higher in Aldh2-/- mice compared with WT controls, but the expression of cell death– and lipolysis-related genes tended to increase but was not statistically significant (Figure 10D).
      Figure thumbnail gr10
      Figure 10Ablation of the Aldh2 gene does not affect acute alcohol-induced adipocyte death. Aldh2-/- and WT mice were subjected to a 6 g/kg single alcohol gavage and killed 9 hours after alcohol administration. (A) White adipose tissue was subjected to evaluate ethanol and acetaldehyde levels. (B) Representative staining images of H&E, and TUNEL staining of white adipose tissue. (C) Caspase 3/7 activity in epididymal fat was assessed. (D) White adipose tissues were subjected to RT-qPCR analysis. Data are expressed as the means ± SEM. ∗P < .05 vs the corresponding controls.

      Ethanol Directly Induces Adipocyte Death and ER Stress in Cultured Adipocytes

      The earlier-described data revealed that a high concentration of ethanol but not acetaldehyde correlates with greater adipocyte death in vivo, suggesting ethanol but not acetaldehyde induces adipocyte death. To investigate the effects of ethanol on adipocyte injury in the in vitro setting, we analyzed adipocyte death by annexin V and propidium iodide (PI) staining. As shown in Figure 11A, ethanol exposure to a differentiated adipocyte cell line (3T3-L1) markedly increased annexin-V and PI staining. Furthermore, ethanol treatment induced adipocyte death as evidenced by an increase of Cyto c ox gene copy, DNA fragmentation, and expression of several apoptosis-related genes (Figure 11B). To understand the mechanisms by which ethanol induces adipocyte death and lipolysis, we treated the differentiated pre-adipocytes from white adipose tissues with ethanol, and then performed immunoblotting and RT-qPCR analyses for ER stress– and lipolysis-related proteins. As illustrated in Figure 11C and D, ethanol treatment markedly increased the expression of several ER stress– or lipolysis-related proteins and genes in differentiated adipocytes.
      Figure thumbnail gr11
      Figure 11In vitro treatment with ethanol induces adipocyte death and ER stress. (A and B) Differentiated 3T3-L1 cells were treated with 100 mmol/L ethanol. (A) Representative images for annexin V and PI staining to evaluate cell death. (B) The copy number of mitochondrial cyto c ox levels from total DNA extraction and DNA fragmentation were evaluated, and the mRNA levels of cell death–associated genes were determined by RT-qPCR analysis. (C and D) Isolated stromal vascular fractions from mouse white adipose tissue were differentiated and treated with ethanol (100 mmol/L) for 24 hours. (C) Cultured cells were collected and analyzed using Western blot, and (D) mRNA expression was evaluated using RT-qPCR. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .001 vs the corresponding controls. DAPI, 4′,6-diamidino-2-phenylindole. ctrl, control.

      Inhibition of Adipocyte Death Ameliorates Acute Alcohol or Acute-on-Chronic Ethanol-Induced Liver ER Stress and Injury

      To examine whether adipocyte death induced by binge alcohol gavage contributes to alcohol-induced lipolysis and liver injury, we developed adipocyte-specific Bcl2 transgenic mice (Bcl2AdipoTg) in which anti-apoptotic BCL2 protein was specifically overexpressed in adipose tissue. Bcl2AdipoTg mice had less adipocyte death after ethanol gavage, as evidenced by reduction of CLS formation and TUNEL+ cells, and lower caspase 3/7 activity compared with WT mice (Figure 12A and B). Less adipocytes death in Bcl2AdipoTg mice correlated with reduced adipocyte lipolysis in these mice, as indicated by down-regulated expression of lipolysis-related genes (Figure 12B) and decreased serum FFA levels (Figure 12C). Blood ethanol and acetaldehyde levels were comparable between Bcl2AdipoTg and WT mice after a single ethanol gavage (Figure 12C). We further examined acute alcoholic liver injury in Bcl2AdipoTg and WT mice. Serum ALT levels, hepatic TG levels, and hepatic mRNA expression of several lipid metabolism–, ER stress–, and cell death–related genes were lower in Bcl2AdipoTg mice compared with WT mice after ethanol binge (Figure 12C and D).
      Figure thumbnail gr12
      Figure 12Bcl2AdipoTG mice are resistant to acute ethanol-induced adipocyte death and liver injury. Bcl2AdipoTG mice and littermate control mice were subjected to binge alcohol gavage (7 g/kg) and killed 9 hours after alcohol administration. (A) Representative staining images of H&E, and TUNEL staining on white adipose tissues. (B) Caspase 3/7 activity and RT-qPCR analysis were conducted on white adipose tissues. (C) Serum ethanol, acetaldehyde, FFA, and hepatic TG levels were assessed. (D) RT-qPCR study of liver tissue lysates. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .01 vs the corresponding controls.
      Resistance to ethanol-induced adipocyte death in Bcl2AdipoTg mice also was found in an acute-on-chronic ethanol feeding model as shown by the results that Bcl2AdipoTg mice had lower levels of caspase 3/7 activity in adipose tissues than WT mice after ethanol gavage (Figure 13A). Bcl2AdipoTg mice had lower levels of serum FFAs and reduced expression of several lipolysis-related genes in adipose tissues (Figure 13B and C). Furthermore, serum ALT levels and hepatic TG levels were lower in Bcl2AdipoTg mice than in WT mice after chronic-plus-binge ethanol feeding (Figure 13D and E). Hepatic expressions of several ER stress– and DNA damage–related mRNAs/proteins were lower in ethanol-fed Bcl2AdipoTg mice compared with WT mice after chronic-plus-binge ethanol feeding (Figure 13F and G).
      Figure thumbnail gr13
      Figure 13Bcl2AdipoTG mice are resistant to chronic-plus-binge ethanol-induced adipocyte death, lipolysis, and hepatic ER stress. Bcl2AdipoTg mice and their littermate control mice were subjected to E10d+1B ethanol feeding. Adipose and liver tissues were collected 9 hours postbinge. White adipose tissues were collected for the measurement of (A) caspase 3/7 activity, (B) serum FFA levels, and (C) RT-qPCR analyses. (D) Sera were collected for the measurement of ALT levels. Liver tissues were collected for the measurement of (E) liver TG levels, (F) RT-qPCR analyses of ER stress–related genes, and (G) Western blot analysis. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .01 vs the corresponding controls. STAT3, _____.
      To further explore the effect of adipocyte death on alcohol-induced liver injury, we also used BclxL adipocyte-specific knockout (KO) mice. After acute-on-chronic ethanol feeding, BclxLAdipoKO mice showed increased adipocyte death (higher levels of CLS formation and caspase 3/7 activity in adipose tissue) (Figure 14A and B) and increased lipolysis (higher expression of lipolysis-related genes in adipose tissue) (Figure 14C) compared with WT mice. Serum FFA levels also were higher in BclxLAdipoKO mice compared with controls (Figure 14D). Furthermore, BclxLAdipoKO mice had more steatosis, increased caspase 3/7 activity, and greater expression of several ER stress–related genes in the liver than WT mice after chronic-plus-binge ethanol feeding (Figure 14E and F). There were no statistical differences in serum ALT levels between BclxLAdipoKO and WT mice after chronic-plus-binge ethanol feeding (Figure 14G).
      Figure thumbnail gr14
      Figure 14Deletion of the BclxL gene in adipocytes enhances lipolysis and liver TG synthesis after chronic-plus-binge ethanol feeding. BclxLAdipoKO mice and their littermate control mice were subjected to E10d+1B ethanol feeding. Mice were killed 9 hours after the gavage for analyses. White adipose tissues were subjected to (A) H&E staining, (B) the measurement of caspase 3/7 activity, and (C) RT-qPCR analysis. (D) Sera were collected for the measurement of FFA levels. Liver tissues were collected for (E) H&E staining, measurement of hepatic TG and caspase 3/7 activity, and (F) RT-qPCR analysis. (G) Sera were collected for the measurement of ALT levels. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .001 vs the corresponding controls.

      Nonoxidative Ethanol Metabolite FAEEs Contribute to Acute Alcohol-Induced Liver Injury

      In addition to the oxidative process converting alcohol to acetaldehyde by alcohol-metabolizing enzymes, a nonoxidative alcohol metabolism also has been implicated in the pathogenesis of alcohol-induced organ damage via the production of FAEEs (Figure 15A).
      • Best C.A.
      • Laposata M.
      Fatty acid ethyl esters: toxic non-oxidative metabolites of ethanol and markers of ethanol intake.
      Our data suggest that acetaldehyde does not play a key role in acute liver injury after a single ethanol binge, so we wondered whether nonoxidative ethanol metabolites, FAEEs, contribute to acute ethanol-induced liver injury. We evaluated serum FAEE levels using gas chromatography with a flame ionization detector, as previously described.
      • Huang W.
      • Booth D.M.
      • Cane M.C.
      • Chvanov M.
      • Javed M.A.
      • Elliott V.L.
      • Armstrong J.A.
      • Dingsdale H.
      • Cash N.
      • Li Y.
      • Greenhalf W.
      • Mukherjee R.
      • Kaphalia B.S.
      • Jaffar M.
      • Petersen O.H.
      • Tepikin A.V.
      • Sutton R.
      • Criddle D.N.
      Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
      After acute alcohol administration, a significant increase in serum FAEEs was observed compared with those in controls (Figure 15B). Intriguingly, serum FAEE levels were almost 3 times higher in Adh1-/- mice than those in WT mice. The major FAEEs were composed of palmitic acid ethyl ester (16:0 ethyl ester), stearic acid ethyl ester (18:0 ethyl ester), and oleic acid ethyl ester (18:1n9 ethyl ester) (Figure 15C). Similarly, Adh1-/- mice fed with a HFD for 3 months and a single ethanol binge showed higher levels of FAEEs compared with those in WT mice (Figure 15C). Taken together, acute alcohol administration lead to an increase in serum FAEEs, and the inhibition of oxidative alcohol metabolism in Adh1-/- mice resulted in an increase in the production of nonoxidative ethanol metabolites in both chow- and HFD-fed mice.
      Figure thumbnail gr15
      Figure 15Binge ethanol promotes the production of FAEEs in WT and Adh1-/- mice. (A) A schematic overview of oxidative and nonoxidative alcohol metabolism. (B) Serum FAEEs were extracted using an aminopropyl column in solid-phase extraction, and FAEEs were detected using gas chromatography/flame ionization detection methods. The GLC-462 EE reference standards were used. (C) Levels of serum FAEEs were evaluated using serum samples from acute alcohol binge (7 g/kg) and 3M HFD-plus-binge alcohol (5 g/kg). Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .001 vs the corresponding controls. FID, ______; MEOS, microsomal ethanol oxidizing system; PBS, phosphate-buffered saline; 3M, ______.
      Next, we investigated the hepatic expression of the FAEE synthesis–associated gene Ces1d. As shown in Figure 16A, the highest expression of Ces1d was detected in the liver compared with other organs. In the liver, Ces1d was detected mainly in hepatocytes, while its expression was detected at very low levels in other nonhepatic parenchymal cells. To examine the role of Ces1d in acute alcohol-induced liver injury, Ces1d-/- and WT mice were subjected to a single ethanol binge. Serum levels of ethanol and acetaldehyde were comparable between Ces1d-/- and WT mice, while the levels of serum FAEEs were much lower in Ces1d-/- mice than in WT mice after acute ethanol gavage (Figure 16B). A small reduction in serum ALT levels was observed in ethanol-fed Ces1d-/- mice compared with ethanol-fed WT mice, which reached a statistical difference when a large number of mice were used (Figure 16C). In addition, the hepatic expression of several ER stress–mediated proteins was lower in Ces1d-/- mice than in WT mice (Figure 16D). Cel is another important FAEE synthesis enzyme to catalyze FAEE synthesis, however, Cel mRNA was expressed mainly in the pancreas and hardly detected in the liver.
      • Huang W.
      • Booth D.M.
      • Cane M.C.
      • Chvanov M.
      • Javed M.A.
      • Elliott V.L.
      • Armstrong J.A.
      • Dingsdale H.
      • Cash N.
      • Li Y.
      • Greenhalf W.
      • Mukherjee R.
      • Kaphalia B.S.
      • Jaffar M.
      • Petersen O.H.
      • Tepikin A.V.
      • Sutton R.
      • Criddle D.N.
      Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
      Here, we also found the CEL protein expression was detected at high levels in the pancreas but not in the liver tissues (Figure 16E). Deletion of the Cel gene did not attenuate acute alcohol-induced liver injury (Figure 16F). Taken together, Ces1d is highly expressed in hepatocytes and partially contributes to acute alcohol-induced liver injury via FAEE production, while carboxyl ester lipase CEL does not contribute significantly to acute alcohol-induced liver injury.
      Figure thumbnail gr16
      Figure 16Deletion of the Ces1d gene reduces acute ethanol-induced serum FAEE and ALT increase. (A) RT-qPCR analysis of Ces1d mRNA in multiple organs and cells in the liver from C57BL/6 mice. (B–D) Ces1d-/- mice and littermate control mice were administered alcohol gavage (7 g/kg) and killed 9 hours after alcohol administration. (B) Serum ethanol, acetaldehyde, and FAEE levels were evaluated. (C) Serum ALT levels were evaluated. (D) Protein expression was assessed by Western blot on liver tissue lysates. (E and F) Cel-/- mice and littermate control mice were administered alcohol gavage (7 g/kg) and killed 9 hours after alcohol administration. (E) CEL protein expression in the liver and pancreas was evaluated. (F) Serum ALT levels were measured. Data are expressed as the means ± SEM. ∗P < .05, ∗∗P < .001 vs the corresponding controls.

      Discussion

      In the current study, we extensively studied the mechanisms of ethanol binge-induced liver injury by using various lines of genetically modified mice. Several interesting findings were observed. First, ethanol, not acetaldehyde, directly contributes to acute alcohol-induced liver injury by inducing ER stress and fatty acid synthesis in the liver. Second, ethanol induces adipocyte death and lipolysis, resulting in an increase in FFAs and liver injury. Third, FAEEs, nonoxidative ethanol metabolites, contribute to acute liver injury in our ethanol binge model. Our working model of acute alcoholic liver injury is shown in the graphical abstract.
      In human beings, the development of ALD is associated with the quantity and duration of alcohol consumed.
      • Teli M.R.
      • Day C.P.
      • Burt A.D.
      • Bennett M.K.
      • James O.F.
      Determinants of progression to cirrhosis or fibrosis in pure alcoholic fatty liver.
      ,
      • Becker U.
      • Deis A.
      • Sorensen T.I.
      • Gronbaek M.
      • Borch-Johnsen K.
      • Muller C.F.
      • Schnohr P.
      • Jensen G.
      Prediction of risk of liver disease by alcohol intake, sex, and age: a prospective population study.
      Liver is the major organ that metabolizes more than 90% of ingested alcohol into acetaldehyde through several enzymatic mechanisms,
      • Jiang Y.
      • Zhang T.
      • Kusumanchi P.
      • Han S.
      • Yang Z.
      • Liangpunsakul S.
      Alcohol metabolizing enzymes, microsomal ethanol oxidizing system, cytochrome P450 2E1, catalase, and aldehyde dehydrogenase in alcohol-associated liver disease.
      although our recent studies have suggested that liver ALDH2 is responsible for less than 50% of blood acetaldehyde clearance.
      • Guillot A.
      • Ren T.
      • Jourdan T.
      • Pawlosky R.J.
      • Han E.
      • Kim S.J.
      • Zhang L.
      • Koob G.F.
      • Gao B.
      Targeting liver aldehyde dehydrogenase-2 prevents heavy but not moderate alcohol drinking.
      Several studies have shown that acetaldehyde is one of the principal culprits mediating chronic alcoholic liver injury and fibrogenic effects.
      • Setshedi M.
      • Wands J.R.
      • Monte S.M.
      Acetaldehyde adducts in alcoholic liver disease.
      An increased level of acetaldehyde during chronic alcohol consumption impairs cellular function by forming adducts with DNA and proteins.
      • Setshedi M.
      • Wands J.R.
      • Monte S.M.
      Acetaldehyde adducts in alcoholic liver disease.
      However, the role of acetaldehyde in mediating liver injury induced by binge ethanol is not known. Binge drinking leads to a transient increase and a rapid decrease in the levels of acetaldehyde because of its very short half-life, approximately 18–31 minutes.
      • Jones A.W.
      • Neiman J.
      • Hillbom M.
      Elimination kinetics of ethanol and acetaldehyde in healthy men during the calcium carbimide-alcohol flush reaction.
      To explore the role of ethanol and acetaldehyde in acute alcoholic liver injury, we used Adh1-/- and Aldh2-/- mouse models in which ethanol metabolism was markedly inhibited. Interestingly, we found that acute alcoholic liver injury was markedly exacerbated in mice lacking the key ethanol metabolism enzyme ADH1, as indicated by an increase in serum alcohol concentration, serum transaminase levels, hepatic ER stress, and hepatocyte apoptosis after acute ethanol gavage. These results suggest that liver injury in an ethanol binge model likely is acetaldehyde-independent. To further test this hypothesis, we conducted experiments in mice lacking Aldh2, an oxidative enzyme converting acetaldehyde to acetate. Despite an increase in blood acetaldehyde after ethanol binge, Aldh2-/- mice had a similar liver injury (serum ALT levels) as WT mice. Given the combination of binge drinking and the presence of metabolic syndrome as a major risk of ALD,
      • Ventura-Cots M.
      • Watts A.E.
      • Bataller R.
      Binge drinking as a risk factor for advanced alcoholic liver disease.
      ,
      • Aberg F.
      • Helenius-Hietala J.
      • Puukka P.
      • Jula A.
      Binge drinking and the risk of liver events: a population-based cohort study.
      we also determined the implications of ethanol and acetaldehyde in liver injury using the HFD+binge model in Adh1-/- and Aldh2-/- mice. We again observed enhanced liver injury and activation of the hepatic ER stress pathway in Adh1-/- mice challenged with HFD+binge compared with WT mice, whereas the lack of Aldh2 did not affect liver injury in this model. Taken together, our results suggest that the mechanism underlying liver injury induced by binge ethanol intake is acetaldehyde-independent and directly related to ethanol. This notion was confirmed further in our experiments when we found that intraperitoneal administration of ethanol, but not acetaldehyde, induces liver injury, ER stress, and hepatocyte death.
      To investigate how ethanol causes liver injury in a single ethanol binge model, we carefully analyzed our transcriptomic data in the liver of mice receiving ethanol binge at 2 doses (5 and 7 g/kg). Our analyses showed that a single ethanol binge significantly up-regulated hepatic expression of genes related to fatty acid synthesis and inflammatory response but down-regulated the genes associated with fatty acid oxidation. In addition to de novo lipogenesis within the hepatocytes, adipose tissue lipolysis is another important source of hepatic fatty acids.
      • Liangpunsakul S.
      • Chalasani N.
      Lipid mediators of liver injury in nonalcoholic fatty liver disease.
      ,
      • Donnelly K.L.
      • Smith C.I.
      • Schwarzenberg S.J.
      • Jessurun J.
      • Boldt M.D.
      • Parks E.J.
      Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease.
      Alcohol disturbs adipose tissue functions by mediating adipocyte death, altering secretion of proinflammatory mediators, and release of FFAs.
      • Parker R.
      • Kim S.J.
      • Gao B.
      Alcohol, adipose tissue and liver disease: mechanistic links and clinical considerations.
      We previously showed that adipocyte death of epididymal fat promotes liver injury by stimulating adipose tissue lipolysis, inflammation, and FFA release.
      • Kim S.J.
      • Feng D.
      • Guillot A.
      • Dai S.
      • Liu F.
      • Hwang S.
      • Parker R.
      • Seo W.
      • He Y.
      • Godlewski G.
      • Jeong W.I.
      • Lin Y.
      • Qin X.
      • Kunos G.
      • Gao B.
      Adipocyte death preferentially induces liver injury and inflammation through the activation of chemokine (C-C Motif) receptor 2-positive macrophages and lipolysis.
      To conclusively address the role of adipocyte death in inducing liver injury in our ethanol binge model, we performed experiments in Bcl2AdipoTg mice, a model using the anti-apoptotic BCL2 protein to inhibit adipocyte death. We found that inhibition of adipocyte death ameliorated acute liver injury and hepatic ER stress in our model, suggesting that an increase in lipolysis secondary to adipocyte death is a driver of acute liver injury in a single ethanol binge model. Furthermore, we provided several lines of evidence suggesting that ethanol, not acetaldehyde, contributes to adipocyte death after acute ethanol gavage. First, we found a high concentration of alcohol in white adipose tissues, which was a comparable amount to that in the liver after ethanol gavage. The levels of acetaldehyde, however, were much lower in adipose tissues, likely reflecting the lower amount of ADH1 when compared with that in the liver.
      • Crabb D.W.
      • Zeng Y.
      • Liangpunsakul S.
      • Jones R.
      • Considine R.
      Ethanol impairs differentiation of human adipocyte stromal cells in culture.
      Second, in our model, a single ethanol binge induced ER stress and adipocyte death, and activated adipose tissue lipolysis, which together likely caused an increase in circulating FFAs. These observations were augmented in Adh1-/- mice, in which we found high levels of ethanol in adipose tissues, but not in Aldh2-/- mice despite high levels of acetaldehyde in these mice. Finally, incubation with ethanol directly induced adipocyte apoptosis in vitro.
      In addition to the oxidative metabolism, the liver uses a nonoxidative pathway to metabolize ethanol by combining ethanol with free fatty acids to produce lipophilic FAEEs.
      • Huang W.
      • Booth D.M.
      • Cane M.C.
      • Chvanov M.
      • Javed M.A.
      • Elliott V.L.
      • Armstrong J.A.
      • Dingsdale H.
      • Cash N.
      • Li Y.
      • Greenhalf W.
      • Mukherjee R.
      • Kaphalia B.S.
      • Jaffar M.
      • Petersen O.H.
      • Tepikin A.V.
      • Sutton R.
      • Criddle D.N.
      Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
      The generation of FAEEs occurs via diverse FAEE synthase enzymes, such as FAEE carboxylesterase (encoded by Ces1d in murine and CES1 in human beings) and Cel.
      • Lange L.G.
      Nonoxidative ethanol metabolism: formation of fatty acid ethyl esters by cholesterol esterase.
      • Tsujita T.
      • Okuda H.
      Fatty acid ethyl ester synthase in rat adipose tissue and its relationship to carboxylesterase.
      • Holmes R.S.
      • Wright M.W.
      • Laulederkind S.J.
      • Cox L.A.
      • Hosokawa M.
      • Imai T.
      • Ishibashi S.
      • Lehner R.
      • Miyazaki M.
      • Perkins E.J.
      • Potter P.M.
      • Redinbo M.R.
      • Robert J.
      • Satoh T.
      • Yamashita T.
      • Yan B.
      • Yokoi T.
      • Zechner R.
      • Maltais L.J.
      Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.
      The distribution of these carboxylases is tissue-specific. The Ces1d gene is highly expressed in the liver, while Cel is located primarily in the pancreas.
      • Huang W.
      • Booth D.M.
      • Cane M.C.
      • Chvanov M.
      • Javed M.A.
      • Elliott V.L.
      • Armstrong J.A.
      • Dingsdale H.
      • Cash N.
      • Li Y.
      • Greenhalf W.
      • Mukherjee R.
      • Kaphalia B.S.
      • Jaffar M.
      • Petersen O.H.
      • Tepikin A.V.
      • Sutton R.
      • Criddle D.N.
      Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
      ,
      • Satoh T.
      • Hosokawa M.
      Carboxylesterases: structure, function and polymorphism.
      FAEEs are important mediators of ethanol-induced organ damage, such as alcohol-induced cardiomyopathy and alcohol-induced pancreatitis.
      • Best C.A.
      • Laposata M.
      Fatty acid ethyl esters: toxic non-oxidative metabolites of ethanol and markers of ethanol intake.
      ,
      • Beckemeier M.E.
      • Bora P.S.
      Fatty acid ethyl esters: potentially toxic products of myocardial ethanol metabolism.
      ,
      • Kaphalia B.S.
      • Cai P.
      • Khan M.F.
      • Okorodudu A.O.
      • Ansari G.A.
      Fatty acid ethyl esters: markers of alcohol abuse and alcoholism.
      We found a significant increase in the level of circulating FAEEs, such as palmitic ethyl ester, stearic ethyl ester, and oleic ethyl ester, in mice receiving a single ethanol binge. Their levels increased further in Adh1-/- mice when ethanol oxidative metabolism is inhibited. Furthermore, deletion of Ces1d markedly reduced serum levels of FAEEs and hepatic ER stress, and reduced serum ALT levels after a single ethanol binge. On the other hand, deletion of Cel, a gene primarily expressed in the pancreas, did not affect acute liver injury after a single ethanol binge. Taken together, our results suggest an important role of hepatic FAEEs in mediating liver injury via activation of ER stress in a single ethanol binge model.

      Clinical and Mechanistic Implications of This Study

      Although it is believed that binge drinking exacerbates ALD, the human and animal data supporting this notion are limited.
      • Ventura-Cots M.
      • Watts A.E.
      • Bataller R.
      Binge drinking as a risk factor for advanced alcoholic liver disease.
      An increase in the levels of serum aminotransferases has been reported among patients with alcohol intoxication, suggesting the possibility of acute liver injury in these patients.
      • Tseng Y.M.
      • Jin Y.R.
      • Chen I.J.
      • Huang F.D.
      • Wu S.H.
      • Ma H.
      • Chen S.Y.
      • Tsai L.Y.
      • Tsai S.M.
      • Lee J.H.
      Roles of the genetic variation of alcohol-metabolizing enzymes on biomarkers in trauma patients with excessive alcohol intake at emergency department.
      ,
      • Ren R.
      • He Y.
      • Ding D.
      • Cui A.
      • Bao H.
      • Ma J.
      • Hou X.
      • Li Y.
      • Feng D.
      • Li X.
      • Liangpunsakul S.
      • Gao B.
      • Wang H.
      Aging exaggerates acute-on-chronic alcohol-induced liver injury in mice and humans by inhibiting neutrophilic sirtuin 1-C/EBPalpha-miRNA-223 axis.
      In a large cohort of more than 6000 patients without baseline liver disease, binge drinking frequency is associated directly with ALD and its association is more pronounced in patients with metabolic syndrome.
      • Ventura-Cots M.
      • Watts A.E.
      • Bataller R.
      Binge drinking as a risk factor for advanced alcoholic liver disease.
      The mechanism underlying these findings in human studies remains obscured. Our findings that ethanol, not acetaldehyde, is the key driver of acute liver injury in our model deserves further discussion, especially in the context of allelic variants of ADH and ALDH and their enzymatic activities to metabolize ethanol.
      • Jiang Y.
      • Zhang T.
      • Kusumanchi P.
      • Han S.
      • Yang Z.
      • Liangpunsakul S.
      Alcohol metabolizing enzymes, microsomal ethanol oxidizing system, cytochrome P450 2E1, catalase, and aldehyde dehydrogenase in alcohol-associated liver disease.
      It was reported that serum ALT levels were much lower in alcohol-intoxicated patients with ALDH2∗1/2 (low activity) than those with ALDH2∗1/1 (full activity).
      • Tseng Y.M.
      • Jin Y.R.
      • Chen I.J.
      • Huang F.D.
      • Wu S.H.
      • Ma H.
      • Chen S.Y.
      • Tsai L.Y.
      • Tsai S.M.
      • Lee J.H.
      Roles of the genetic variation of alcohol-metabolizing enzymes on biomarkers in trauma patients with excessive alcohol intake at emergency department.
      Whether patients with a genetic variant leading to low ADH enzymatic activity are more susceptible to acute liver injury from binge drinking should be explored further. In summary, in a single ethanol binge model, we found that ethanol and its nonoxidative metabolites (FAEEs), not acetaldehyde, promote acute alcohol-induced liver injury by inducing ER stress, adipocyte death, and lipolysis.

      Materials and Methods

      Animal Experiments

      The following lines of genetically modified mice were used in this study: Adh1-/-, Aldh2-/-, Chop-/-, Cyp2e1-/-, Bcl2AdipoTG, BclxLAdipoKO, and Ces1d-/- mice. In detail, Adh1-/- and Aldh2-/- mice and their WT controls were described previously.
      • Deltour L.
      • Foglio M.H.
      • Duester G.
      Metabolic deficiencies in alcohol dehydrogenase Adh1, Adh3, and Adh4 null mutant mice. Overlapping roles of Adh1 and Adh4 in ethanol clearance and metabolism of retinol to retinoic acid.
      ,
      • Kitagawa K.
      • Kawamoto T.
      • Kunugita N.
      • Tsukiyama T.
      • Okamoto K.
      • Yoshida A.
      • Nakayama K.
      • Nakayama K.
      Aldehyde dehydrogenase (ALDH) 2 associates with oxidation of methoxyacetaldehyde; in vitro analysis with liver subcellular fraction derived from human and Aldh2 gene targeting mouse.
      Chop-/- mice were purchased from Jax Laboratory (Bar Harbor, ME). Cyp2e1-/- mice were kindly provided by Dr B. J. Song (National Institute on Alcohol Abuse and Alcoholism) and backcrossed to a C57B/6N background for more than 10 generations. Cre-inducible Bcl2 transgenic mice were described previously
      • Xiang X.
      • Feng D.
      • Hwang S.
      • Ren T.
      • Wang X.
      • Trojnar E.
      • Matyas C.
      • Mo R.
      • Shang D.
      • He Y.
      • Seo W.
      • Shah V.H.
      • Pacher P.
      • Xie Q.
      • Gao B.
      Interleukin-22 ameliorates acute-on-chronic liver failure by reprogramming impaired regeneration pathways in mice.
      and were used to generate adipocyte-specific Bcl2 transgenic mice (Bcl2AdipoTG) with Bcl2 overexpression by crossing with AdipoCre mice (Jax Laboratory). Bcl-xL floxed mice were kindly provided by Dr You-Wen He (University of North Carolina) and were used to generate adipocyte-specific Bcl-xL KO mice by crossing with AdipoCre mice (Jax Laboratory). Ces1d-/- mice on a C57BL/6 background were described previously,
      • Wei E.
      • Ben Ali Y.
      • Lyon J.
      • Wang H.
      • Nelson R.
      • Dolinsky V.W.
      • Dyck J.R.
      • Mitchell G.
      • Korbutt G.S.
      • Lehner R.
      Loss of TGH/Ces3 in mice decreases blood lipids, improves glucose tolerance, and increases energy expenditure.
      heterozygous Ces1d+/- mice were crossed to generate Ces1d-/- mice and their littermate WT controls. Unless noted, male mice were used for all experiments. Mice were housed in polycarbonate cages (maximum, 4 mice per cage) and maintained in a temperature- and light-controlled facility (12:12-hour light-dark cycle) under standard food and water ad libitum. For the induction of acute alcoholic liver injury, ethanol (5–7 g/kg) was administered orally or intraperitoneally and mice were killed at different time points. After the administration of ethanol, a heating pad (38°C) was placed under the cage to provide thermal support and to minimize body heat loss. In some experiments, mice were subjected to “acute-on-chronic ethanol feeding” and “HFD-plus-binge ethanol feeding” (denoted as E10d+1B and 3M HFD+binge, respectively) using the models, as described in previous studies.
      • Bertola A.
      • Mathews S.
      • Ki S.H.
      • Wang H.
      • Gao B.
      Mouse model of chronic and binge ethanol feeding (the NIAAA model).
      ,
      • Chang B.
      • Xu M.J.
      • Zhou Z.
      • Cai Y.
      • Li M.
      • Wang W.
      • Feng D.
      • Bertola A.
      • Wang H.
      • Kunos G.
      • Gao B.
      Short- or long-term high-fat diet feeding plus acute ethanol binge synergistically induce acute liver injury in mice: an important role for CXCL1.
      Male mice (age, 6–7 wk) also were fed a HFD (60% kcal fat, D12492; Research Diets, New Brunswick, NJ) or a chow diet (10% kcal fat) for 3 months. In some experiments, ER stress inhibitors (PBA, cat. 8209860025, 1 mg/kg; and TUDCA, cat. 580221, 500 mg/kg; Merck-Millipore, Billerica, MA), JNK inhibitor II (cat. 420119, 20 mg/kg; Merck-Millipore), ethanol (6 g/kg), or acetaldehyde (50 mg/kg) were administered intraperitoneally. All animals received humane care in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. All animal experiments were approved by the National Institute on Alcohol Abuse and Alcoholism Animal Care and Use Committee.

      Histologic Analysis

      The liver and perigonadal adipose tissues were fixed with 10% neutral buffered formalin. After deparaffinization and rehydration, paraffin sections with 4-μm thickness were stained with H&E and Sirius Red. TUNEL staining was performed with an ApopTag Peroxidase In Situ Apoptosis Detection Kit (S7101; Merck-Millipore). Paraffin-embedded liver and adipose tissues were subjected to immunohistochemistry analyses. Endogenous peroxidases were blocked with 3% H2O2 for 30 minutes and nonspecific binding was blocked further with 3% normal goat serum for 1 hour. Tissues were incubated with primary antibody overnight at 4°C and incubated with the ABC staining kit (PK-4001, rabbit IgG; Vector Laboratories, Inc, Burlingame, CA). Reactions were developed with 3,3′-diaminobenzidine tetra hydrochloride peroxidase substrate (SK-4105; Vector Laboratories, Inc), according to the manufacturer’s instructions, and then slides were counterstained with hematoxylin.

      RT-qPCR

      For RT-qPCR assays, total RNA was isolated from tissues or cells with TRIzol reagent (Thermo Fisher Scientific). Total RNA was obtained and reverse-transcribed into complementary DNA (cDNA) using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. RT-qPCR was performed by SYBR Green Real-Time PCR master mix. The mRNA expression levels of the target genes were normalized to β-actin mRNA expression. The mouse primer sequences are shown in Table 1 and were obtained from Thermo Fisher Scientific.
      Table 1▪▪▪
      NameSequence, 5’→3’
      Acta2 (for)CTGACAGAGGCACCACTGAA
      Acta2 (rev)GAAGGAATAGCCACGCTCAG
      Adh1 (for)GCAAAGCTGCGGTGCTATG
      Adh1 (rev)TCACACAAGTCACCCCTTCTC
      Aldh2 (for)GACGCCGTCAGCAGGAAAA
      Aldh2 (rev)CGCCAATCGGTACAACAGC
      Atf6 (for)TCGCCTTTTAGTCCGGTTCTT
      Atf6 (rev)GGCTCCATAGGTCTGACTCC
      Atgl (for)CCACTCACATCTACGGAGCC
      Atgl (rev)TAATGTTGGCACCTGCTTCA
      Bak (for)AGACCTCCTCTGTGTCCTGG
      Bak (rev)AAAATGGCATCTGGACAAGG
      Bax (for)GATCAGCTCGGGCACTTTAG
      Bax (rev)TTGCTGATGGCAACTTCAAC
      Bcl-xl (for)GCTGCATTGTTCCCGTAGAG
      Bcl-xl (rev)GTTGGATGGCCACCTATCTG
      Bcl2 (for)GGTCTTCAGAGACAGCCAGG
      Bcl2 (rev)GATCCAGGATAACGGAGGCT
      Bim (for)GCCCCTACCTCCCTACAGAC
      Bim (rev)GCTCCTGTGCAATCCGTATC
      Bip (for)ATCTTTGGTTGCTTGTCGCT
      Bip (rev)ATGAAGGAGACTGCTGAGGC
      Cd36 (for)CCTGCAAATGTCAGAGGAAA
      Cd36 (rev)GCGACATGATTAATGGCACA
      Chop (for)GACCAGGTTCTGCTTTCAGG
      Chop (rev)CAGCGACAGAGCCAGAATAA
      Col1a1 (for)TAGGCCATTGTGTATGCAGC
      Col1a1 (rev)ACATGTTCAGCTTTGTGGACC
      Col1a2 (for)GGTGAGCCTGGTCAAACGG
      Col1a2 (rev)ACTGTGTCCTTTCACGCCTTT
      Col3a1 (for)TAGGACTGACCAAGGTGGCT
      Col3a1 (rev)GGAACCTGGTTTCTTCTCACC
      Col4a1 (for)CACATTTTCCACAGCCAGAG
      Col4a1 (rev)GTCTGGCTTCTGCTGCTCTT
      Col5a2 (for)TTGGAAACCTTCTCCATGTCAGA
      Col5a2 (rev)TCCCCAGTGGGTGTTATAGGA
      Cxcl1 (for)TCTCCGTTACTTGGGGACAC
      Cxcl1 (rev)CCACACTCAAGAATGGTCGC
      Cyto C ox (for)ACCAAGGCCACCACACTCCT
      Cyto C ox (rev)ACGCTCAGAAGAATCCTGCAAAGAA
      Dgat1 (for)GACGGCTACTGGGATCTGA
      Dgat1 (rev)TCACCACACACCAATTCAGG
      Dr5 (for)GGTCCTCTTGATGGGCTCTC
      Dr5 (rev)GTTGCTGCTTGCTGTGCTAC
      Ero1a (for)CACAGGTACAGTCGTCCAGGT
      Ero1a (rev)CTTGCTCGTTGGACTCCTG
      Ero1b (for)TGACAAAAAGGGGGCCAAGT
      Ero1b (rev)TATCGCACCCAACACAGTCC
      Fabp4 (for)AAGGTGAAGAGCATCATAACCCT
      Fabp4 (rev)TCACGCCTTTCATAACACATTCC
      Fas (for)GCGGGTTCGTGAAACTGATAA
      Fas (rev)GCAAAATGGGCCTCCTTGATA
      Gadd34 (for)GGAGATAGAAGTTGTGGGCG
      Gadd34 (rev)TTTTGGCAACCAGAACCG
      Hif1a (for)ACCTTCATCGGAAACTCCAAAG
      Hif1a (rev)CTGTTAGGCTGGGAAAAGTTAGG
      Hsl (for)CCTGCAAGAGTATGTCACGC
      Hsl (rev)GGAGAGAGTCTGCAGGAACG
      H2afx (for)GGCCTGTGGACAAGAGTTCTAT
      H2afx (rev)GCCCATTAAATCTCCCCACT
      Lcn2 (for)TGGCCCTGAGTGTCATGTG
      Lcn2 (rev)CTCTTGTAGCTCATAGATGGTGC
      Ly6g (for)TGCGTTGCTCTGGAGATAGA
      Ly6g (rev)CAGAGTAGTGGGGCAGATGG
      Pdi (for)CCCCGTGTGTGGAAAAGAGA
      Pdi (rev)AGCCACAGAGTAATGTGCCC
      Srebp1 (for)GGAGCCATGGATTGCACATT
      Srebp1 (rev)GGCCCGGGAAGTCACTGT
      Trail (for)GGTCCTCTTGATGGGCTCTC
      Trail (rev)GTTGCTGCTTGCTGTGCTAC
      Xbp1 (for)AGCAGCAAGTGGTGGATTTG
      Xbp1 (rev)GAGTTTTCTCCCGTAAAAGCTGA
      18S (for)AACTTTCGATGGTAGTCGCCGT
      18S (rev)TCCTTGGATGTGGTAGCCGTTT
      Actb (for)GGCTGTATTCCCCTCCATCG
      Actb (rev)CCAGTTGGTAACAATGCCATGT
      for, forward; rev, reverse.

      Western Blot Analysis

      Tissues or cell lysates were homogenized in RIPA lysis buffer at 4°C and centrifuged at 10,000 × g for 10 minutes. After tissue homogenization, the supernatants were mixed with loading buffer and subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis and the lysates were subjected to 4%–12% Tri-glycine gradient gels (Criterion XT; Bio-Rad). The extracted proteins were transferred onto nitrocellulose membranes. Membranes were blocked in 5% milk, incubated with primary antibodies at 1:1000 in PBST. Protein bands were visualized by SuperSignal West Femto Maximum Sensitivity Substrate (#34096; Thermo Fisher Scientific). Comparative amounts were normalized with β-actin.

      Antibodies

      Primary antibodies specific for the following proteins were used. For Western blot analysis, antibodies against ADH1 (5295s; CST), ALDH2 (ab194587; Abcam), CYP2E1 (AB1252; Sigma), p-SAPK/JNK (Thr183/Tyr185) (#4668s; CST), SAPK/JNK (#9258; CST), p-PERK (Thr982) (#3179s; CST), PERK (C33E10) (#3192; CST), p-eIF2α (Ser51) (#3398; CST), eIF2α (#5324; CST), p-IRE1α (phospho-S724) (ab48187; Abcam), IRE1α (14C10) (#3294; CST), XBP-1s (E9V3E) (#40435; CST), CHOP (#5554s; CST), BAD (D24A9) (#9239; CST), BIM (C34C5) (#2933; CST), BiP (#3177s; CST), p-histone H2A.X (Ser139) (#9718; CST), HIF-1α (D2U3T) (#14179; CST), ATF6 (D4Z8V) (#65880; CST), FASN (#3189; CST), SCD1 (C12H5) (#2794; CST), adipose triglyceride lipase (#2138; CST), Ero1-Lα (#3264; CST), p-PKA c (Thr197) (#4781; CST), PKA c (#4782; CST), p-HSL (Ser660) (#4126; CST), HSL (#4107; CST), p-STAT3 (Tyr705) (#9145; CST), and STAT3 (#30835; CST) were used. Prediluted rabbit anti-F4/80 (CST) antibody was used for immunohistochemistry. Secondary antibodies for Western blot analyses were horseradish-peroxidase–linked anti-rabbit IgG (#7074; CST) and horseradish-peroxidase–linked anti-mouse IgG (#7076; CST) at 1:5000 dilutions.

      Serum Biochemical Analyses

      Serum was collected for the evaluation of ALT and AST using the VetTest Chemistry analyzer (IDEXX Laboratories), according to the manufacturer’s instructions. Levels of serum ethanol, acetaldehyde, and hepatic FFAs were evaluated using gas chromatography–mass spectrometry. Serum FFA levels were measured with a commercial kit from BioVision (#K612; Milpitas, CA), according to the manufacturer’s instructions. The results were obtained using the Infinite M200 Promicroplate reader (Tecan Group Ltd), equipped at Ewha Drug Development Research Core Center.

      FAEE Identification and Quantification

      A quantitative internal standard of ethyl heptadecanoate (E17:0) was added to the collected serum samples, and the lipids were extracted with acetone/hexane. Then, the FAEEs were isolated by solid-phase extraction using an aminopropyl column (1 mL/100 mg; Thermo Fisher Scientific), as described previously.
      • Huang W.
      • Booth D.M.
      • Cane M.C.
      • Chvanov M.
      • Javed M.A.
      • Elliott V.L.
      • Armstrong J.A.
      • Dingsdale H.
      • Cash N.
      • Li Y.
      • Greenhalf W.
      • Mukherjee R.
      • Kaphalia B.S.
      • Jaffar M.
      • Petersen O.H.
      • Tepikin A.V.
      • Sutton R.
      • Criddle D.N.
      Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
      ,
      • Best C.A.
      • Laposata M.
      Fatty acid ethyl esters: toxic non-oxidative metabolites of ethanol and markers of ethanol intake.
      ,
      • Kaluzny M.A.
      • Duncan L.A.
      • Merritt M.V.
      • Epps D.E.
      Rapid separation of lipid classes in high yield and purity using bonded phase columns.
      The purified FAEEs were separated, identified, and quantitated by gas chromatography/flame ionization detector.

      GTT and ITT

      Animals were fasted overnight for GTT and fasted for 6 hours for ITT. Blood was collected through tail vein at 0, 15, 30, 45, 60, and 120 minutes after intraperitoneal injection of glucose (0.75 g/kg) or insulin (1.5 IU/kg). The glucose levels were measured by a digital glucometer.

      Immunofluorescence Staining

      The cultured cells were stained with an Annexin V/PI double staining kit (#101-100; BioVision) to detect cell death, according to the manufacturer’s instructions. The images were obtained using a LSM710 confocal microscope (Zeiss, Thornwood, NY).

      Cell Death Assay

      DNA fragmentation was measured with a cell death detection kit (#11544675001; Sigma-Aldrich). Samples were prepared and measured according to the manufacturer’s instructions. Caspase 3/7 activities in the adipose tissue samples were measured with a commercial kit (#G7791; Promega, Madison, WI), according to the manufacturer’s instructions.

      Isolation of Stromal Vascular Fraction Cells

      Perigonadal adipose tissues were harvested from mice and digested with collagenase A (#10103578001; Roche). Adipocytes and preadipocytes were separated by centrifugation (1500 rpm, 5 min), and preadipocytes were resuspended for adipocyte differentiation.

      Cell Culture

      Cells were cultured in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum and penicillin/streptomycin solution (#15140122; Gibco) and maintained in a humidified incubator at 37ºC and 5% CO2. After reaching confluence, 3T3-L1 or stromal vascular fraction cells were cultured with 10% fetal bovine serum, 0.125 mmol/L indomethacin, 1 μmol/L dexamethasone, 0.5 mmol/L IBMX, 0.02 μmol/L insulin, and 1 μmol/L rosiglitazone to induce differentiation for 2 days. The media then were replaced with 10% fetal bovine serum, insulin, and rosiglitazone. The media were renewed every 2–3 days during cell culture.

      Microarray Analyses of Mouse Liver Samples

      Liver samples from mice with ethanol (5 or 7 g/kg) gavage or maltose (control) were subjected to microarray analysis. Dye-coupled cDNAs were isolated by using a MiniElute PCR purification kit (Qiagen) and hybridized to an Agilent 44K mouse 60-mer oligo microarray (Agilent Technologies, Santa Clara, CA). The Genespring GX software package (Agilent Technologies) was used to process and normalize the data. The raw data from the maltose control and 5-g/kg ethanol groups were published previously and deposited in NCBI’s Gene Expression Omnibus (accession number: GSE98153).
      • Zhou Z.
      • Xu M.J.
      • Cai Y.
      • Wang W.
      • Jiang J.X.
      • Varga Z.V.
      • Feng D.
      • Pacher P.
      • Kunos G.
      • Torok N.J.
      • Gao B.
      Neutrophil-hepatic stellate cell interactions promote fibrosis in experimental steatohepatitis.
      The liver tissue microarray data from 7-g/kg ethanol gavaged mice have been deposed in NCBI’s Gene Expression Omnibus (GSE214778). Differential expression analysis was performed via the R package DESeq2 (v1.30.1). Genes with fold change >1.5 and an adjusted P value less than .05 were put into gene set enrichment analysis via the R package cluster Profiler (v3.18.1). The R package heatmap (v1.0.12) was used to generate the heatmap plots. Interactive Venn diagrams and gene function analyses were processed by ingenuity pathway analysis.

      Statistical Analysis

      Data are presented as means ± SEM (n = 6–15 per group). Statistical analysis was performed using the 2-tailed Student t test or 1-way analysis of variance. All P < .05 values were considered statistically significant.

      CRediT Authorship Contributions

      Seol Hee Park (Conceptualization: Lead; Data curation: Lead; Formal analysis: Lead; Writing – original draft: Lead)
      Wonhyo Seo (Conceptualization: Lead; Data curation: Lead; Formal analysis: Lead; Writing – original draft: Lead)
      Mingjiang Xu (Conceptualization: Equal; Methodology: Equal)
      Byran Mackowiak (Methodology: Supporting)
      Yuhong Lin (Methodology: Supporting)
      Yong He (Methodology: Supporting)
      Yaojie Fu (Methodology: Supporting)
      Seonghwang Hwang (Methodology: Supporting)
      Seung-Jin Kim (Methodology: Supporting)
      Yukun Guan (Methodology: Supporting)
      Dechun Feng (Methodology: Supporting)
      liqing Yu (Methodology: Supporting)
      Richard Lehner (Methodology: Supporting)
      Suthat Liangpunsakul (Methodology: Supporting)
      Bin Gao, MD, PhD (Conceptualization: Lead; Data curation: Supporting; Formal analysis: Supporting; Funding acquisition: Lead; Supervision: Lead; Writing – review & editing: Lead)

      References

        • Liangpunsakul S.
        • Haber P.
        • McCaughan G.W.
        Alcoholic liver disease in Asia, Europe, and North America.
        Gastroenterology. 2016; 150: 1786-1797
        • Teli M.R.
        • Day C.P.
        • Burt A.D.
        • Bennett M.K.
        • James O.F.
        Determinants of progression to cirrhosis or fibrosis in pure alcoholic fatty liver.
        Lancet. 1995; 346: 987-990
        • Becker U.
        • Deis A.
        • Sorensen T.I.
        • Gronbaek M.
        • Borch-Johnsen K.
        • Muller C.F.
        • Schnohr P.
        • Jensen G.
        Prediction of risk of liver disease by alcohol intake, sex, and age: a prospective population study.
        Hepatology. 1996; 23: 1025-1029
        • Fillmore M.T.
        • Jude R.
        Defining "binge" drinking as five drinks per occasion or drinking to a .08% BAC: which is more sensitive to risk?.
        Am J Addict. 2011; 20: 468-475
        • Tapper E.B.
        • Parikh N.D.
        Mortality due to cirrhosis and liver cancer in the United States, 1999-2016: observational study.
        BMJ. 2018; 362k2817
        • Wong T.
        • Dang K.
        • Ladhani S.
        • Singal A.K.
        • Wong R.J.
        Prevalence of alcoholic fatty liver disease among adults in the United States, 2001-2016.
        JAMA. 2019; 321: 1723-1725
        • Ventura-Cots M.
        • Watts A.E.
        • Bataller R.
        Binge drinking as a risk factor for advanced alcoholic liver disease.
        Liver Int. 2017; 37: 1281-1283
        • Aberg F.
        • Helenius-Hietala J.
        • Puukka P.
        • Jula A.
        Binge drinking and the risk of liver events: a population-based cohort study.
        Liver Int. 2017; 37: 1373-1381
        • Jiang Y.
        • Zhang T.
        • Kusumanchi P.
        • Han S.
        • Yang Z.
        • Liangpunsakul S.
        Alcohol metabolizing enzymes, microsomal ethanol oxidizing system, cytochrome P450 2E1, catalase, and aldehyde dehydrogenase in alcohol-associated liver disease.
        Biomedicines. 2020; 8: 50
        • Setshedi M.
        • Wands J.R.
        • Monte S.M.
        Acetaldehyde adducts in alcoholic liver disease.
        Oxid Med Cell Longev. 2010; 3: 178-185
        • Guillot A.
        • Ren T.
        • Jourdan T.
        • Pawlosky R.J.
        • Han E.
        • Kim S.J.
        • Zhang L.
        • Koob G.F.
        • Gao B.
        Targeting liver aldehyde dehydrogenase-2 prevents heavy but not moderate alcohol drinking.
        Proc Natl Acad Sci U S A. 2019; 116: 25974-25981
        • Huang W.
        • Booth D.M.
        • Cane M.C.
        • Chvanov M.
        • Javed M.A.
        • Elliott V.L.
        • Armstrong J.A.
        • Dingsdale H.
        • Cash N.
        • Li Y.
        • Greenhalf W.
        • Mukherjee R.
        • Kaphalia B.S.
        • Jaffar M.
        • Petersen O.H.
        • Tepikin A.V.
        • Sutton R.
        • Criddle D.N.
        Fatty acid ethyl ester synthase inhibition ameliorates ethanol-induced Ca2+-dependent mitochondrial dysfunction and acute pancreatitis.
        Gut. 2014; 63: 1313-1324
        • Lange L.G.
        Nonoxidative ethanol metabolism: formation of fatty acid ethyl esters by cholesterol esterase.
        Proc Natl Acad Sci U S A. 1982; 79: 3954-3957
        • Tsujita T.
        • Okuda H.
        Fatty acid ethyl ester synthase in rat adipose tissue and its relationship to carboxylesterase.
        J Biol Chem. 1992; 267: 23489-23494
        • Holmes R.S.
        • Wright M.W.
        • Laulederkind S.J.
        • Cox L.A.
        • Hosokawa M.
        • Imai T.
        • Ishibashi S.
        • Lehner R.
        • Miyazaki M.
        • Perkins E.J.
        • Potter P.M.
        • Redinbo M.R.
        • Robert J.
        • Satoh T.
        • Yamashita T.
        • Yan B.
        • Yokoi T.
        • Zechner R.
        • Maltais L.J.
        Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.
        Mamm Genome. 2010; 21: 427-441
        • Gao B.
        • Ahmad M.F.
        • Nagy L.E.
        • Tsukamoto H.
        Inflammatory pathways in alcoholic steatohepatitis.
        J Hepatol. 2019; 70: 249-259
        • Liangpunsakul S.
        • Chalasani N.
        Lipid mediators of liver injury in nonalcoholic fatty liver disease.
        Am J Physiol Gastrointest Liver Physiol. 2019; 316: G75-G81
        • Sebastian B.M.
        • Roychowdhury S.
        • Tang H.
        • Hillian A.D.
        • Feldstein A.E.
        • Stahl G.L.
        • Takahashi K.
        • Nagy L.E.
        Identification of a cytochrome P4502E1/Bid/C1q-dependent axis mediating inflammation in adipose tissue after chronic ethanol feeding to mice.
        J Biol Chem. 2011; 286: 35989-35997
        • Zhong W.
        • Zhao Y.
        • Tang Y.
        • Wei X.
        • Shi X.
        • Sun W.
        • Sun X.
        • Yin X.
        • Sun X.
        • Kim S.
        • McClain C.J.
        • Zhang X.
        • Zhou Z.
        Chronic alcohol exposure stimulates adipose tissue lipolysis in mice: role of reverse triglyceride transport in the pathogenesis of alcoholic steatosis.
        Am J Pathol. 2012; 180: 998-1007
        • Mathur M.
        • Yeh Y.T.
        • Arya R.K.
        • Jiang L.
        • Pornour M.
        • Chen W.
        • Ma Y.
        • Gao B.
        • He L.
        • Ying Z.
        • Xue B.
        • Shi H.
        • Choi Y.
        • Yu L.
        Adipose lipolysis is important for ethanol to induce fatty liver in the National Institute on Alcohol Abuse and Alcoholism murine model of chronic and binge ethanol feeding.
        Hepatology. 2022; (Epub ahead of print)
        • Wei X.
        • Shi X.
        • Zhong W.
        • Zhao Y.
        • Tang Y.
        • Sun W.
        • Yin X.
        • Bogdanov B.
        • Kim S.
        • McClain C.
        • Zhou Z.
        • Zhang X.
        Chronic alcohol exposure disturbs lipid homeostasis at the adipose tissue-liver axis in mice: analysis of triacylglycerols using high-resolution mass spectrometry in combination with in vivo metabolite deuterium labeling.
        PLoS One. 2013; 8e55382
        • Gao B.
        • Xu M.J.
        • Bertola A.
        • Wang H.
        • Zhou Z.
        • Liangpunsakul S.
        Animal models of alcoholic liver disease: pathogenesis and clinical relevance.
        Gene Expr. 2017; 17: 173-186
        • Sanz-Garcia C.
        • Poulsen K.L.
        • Bellos D.
        • Wang H.
        • McMullen M.R.
        • Li X.
        • Chattopadhyay S.
        • Sen G.
        • Nagy L.E.
        The non-transcriptional activity of IRF3 modulates hepatic immune cell populations in acute-on-chronic ethanol administration in mice.
        J Hepatol. 2019; 70: 974-984
        • Wang L.
        • You H.M.
        • Meng H.W.
        • Pan X.Y.
        • Chen X.
        • Bi Y.H.
        • Zhang Y.F.
        • Li J.J.
        • Yin N.N.
        • Zhang Z.W.
        • Huang C.
        • Li J.
        STING-mediated inflammation contributes to Gao binge ethanol feeding model.
        J Cell Physiol. 2022; 237: 1471-1485
        • Wang S.
        • Ni H.M.
        • Chao X.
        • Ma X.
        • Kolodecik T.
        • De Lisle R.
        • Ballabio A.
        • Pacher P.
        • Ding W.X.
        Critical role of TFEB-mediated lysosomal biogenesis in alcohol-induced pancreatitis in mice and humans.
        Cell Mol Gastroenterol Hepatol. 2020; 10: 59-81
        • Ma J.
        • Guillot A.
        • Yang Z.
        • Mackowiak B.
        • Hwang S.
        • Park O.
        • Peiffer B.J.
        • Ahmadi A.R.
        • Melo L.
        • Kusumanchi P.
        • Huda N.
        • Saxena R.
        • He Y.
        • Guan Y.
        • Feng D.
        • Sancho-Bru P.
        • Zang M.
        • Cameron A.M.
        • Bataller R.
        • Tacke F.
        • Sun Z.
        • Liangpunsakul S.
        • Gao B.
        Distinct histopathological phenotypes of severe alcoholic hepatitis suggest different mechanisms driving liver injury and failure.
        J Clin Invest. 2022; : 132
        • Jeanblanc J.
        • Rolland B.
        • Gierski F.
        • Martinetti M.P.
        • Naassila M.
        Animal models of binge drinking, current challenges to improve face validity.
        Neurosci Biobehav Rev. 2019; 106: 112-121
        • Cai Y.
        • Xu M.J.
        • Koritzinsky E.H.
        • Zhou Z.
        • Wang W.
        • Cao H.
        • Yuen P.S.
        • Ross R.A.
        • Star R.A.
        • Liangpunsakul S.
        • Gao B.
        Mitochondrial DNA-enriched microparticles promote acute-on-chronic alcoholic neutrophilia and hepatotoxicity.
        JCI Insight. 2017; 2e92634
        • Hu H.
        • Tian M.
        • Ding C.
        • Yu S.
        The C/EBP homologous protein (CHOP) transcription factor functions in endoplasmic reticulum stress-induced apoptosis and microbial infection.
        Front Immunol. 2018; 9: 3083
        • Kim S.J.
        • Feng D.
        • Guillot A.
        • Dai S.
        • Liu F.
        • Hwang S.
        • Parker R.
        • Seo W.
        • He Y.
        • Godlewski G.
        • Jeong W.I.
        • Lin Y.
        • Qin X.
        • Kunos G.
        • Gao B.
        Adipocyte death preferentially induces liver injury and inflammation through the activation of chemokine (C-C Motif) receptor 2-positive macrophages and lipolysis.
        Hepatology. 2019; 69: 1965-1982
        • Best C.A.
        • Laposata M.
        Fatty acid ethyl esters: toxic non-oxidative metabolites of ethanol and markers of ethanol intake.
        Front Biosci. 2003; 8: e202-e217
        • Jones A.W.
        • Neiman J.
        • Hillbom M.
        Elimination kinetics of ethanol and acetaldehyde in healthy men during the calcium carbimide-alcohol flush reaction.
        Alcohol Alcohol Suppl. 1987; 1: 213-217
        • Donnelly K.L.
        • Smith C.I.
        • Schwarzenberg S.J.
        • Jessurun J.
        • Boldt M.D.
        • Parks E.J.
        Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease.
        J Clin Invest. 2005; 115: 1343-1351
        • Parker R.
        • Kim S.J.
        • Gao B.
        Alcohol, adipose tissue and liver disease: mechanistic links and clinical considerations.
        Nat Rev Gastroenterol Hepatol. 2018; 15: 50-59
        • Crabb D.W.
        • Zeng Y.
        • Liangpunsakul S.
        • Jones R.
        • Considine R.
        Ethanol impairs differentiation of human adipocyte stromal cells in culture.
        Alcohol Clin Exp Res. 2011; 35: 1584-1592
        • Satoh T.
        • Hosokawa M.
        Carboxylesterases: structure, function and polymorphism.
        Biomol Ther. 2009; 17: 335-347
        • Beckemeier M.E.
        • Bora P.S.
        Fatty acid ethyl esters: potentially toxic products of myocardial ethanol metabolism.
        J Mol Cell Cardiol. 1998; 30: 2487-2494
        • Kaphalia B.S.
        • Cai P.
        • Khan M.F.
        • Okorodudu A.O.
        • Ansari G.A.
        Fatty acid ethyl esters: markers of alcohol abuse and alcoholism.
        Alcohol. 2004; 34: 151-158
        • Tseng Y.M.
        • Jin Y.R.
        • Chen I.J.
        • Huang F.D.
        • Wu S.H.
        • Ma H.
        • Chen S.Y.
        • Tsai L.Y.
        • Tsai S.M.
        • Lee J.H.
        Roles of the genetic variation of alcohol-metabolizing enzymes on biomarkers in trauma patients with excessive alcohol intake at emergency department.
        Clin Chim Acta. 2008; 389: 14-18
        • Ren R.
        • He Y.
        • Ding D.
        • Cui A.
        • Bao H.
        • Ma J.
        • Hou X.
        • Li Y.
        • Feng D.
        • Li X.
        • Liangpunsakul S.
        • Gao B.
        • Wang H.
        Aging exaggerates acute-on-chronic alcohol-induced liver injury in mice and humans by inhibiting neutrophilic sirtuin 1-C/EBPalpha-miRNA-223 axis.
        Hepatology. 2022; 75: 646-660
        • Deltour L.
        • Foglio M.H.
        • Duester G.
        Metabolic deficiencies in alcohol dehydrogenase Adh1, Adh3, and Adh4 null mutant mice. Overlapping roles of Adh1 and Adh4 in ethanol clearance and metabolism of retinol to retinoic acid.
        J Biol Chem. 1999; 274: 16796-16801
        • Kitagawa K.
        • Kawamoto T.
        • Kunugita N.
        • Tsukiyama T.
        • Okamoto K.
        • Yoshida A.
        • Nakayama K.
        • Nakayama K.
        Aldehyde dehydrogenase (ALDH) 2 associates with oxidation of methoxyacetaldehyde; in vitro analysis with liver subcellular fraction derived from human and Aldh2 gene targeting mouse.
        FEBS Lett. 2000; 476: 306-311
        • Xiang X.
        • Feng D.
        • Hwang S.
        • Ren T.
        • Wang X.
        • Trojnar E.
        • Matyas C.
        • Mo R.
        • Shang D.
        • He Y.
        • Seo W.
        • Shah V.H.
        • Pacher P.
        • Xie Q.
        • Gao B.
        Interleukin-22 ameliorates acute-on-chronic liver failure by reprogramming impaired regeneration pathways in mice.
        J Hepatol. 2020; 72: 736-745
        • Wei E.
        • Ben Ali Y.
        • Lyon J.
        • Wang H.
        • Nelson R.
        • Dolinsky V.W.
        • Dyck J.R.
        • Mitchell G.
        • Korbutt G.S.
        • Lehner R.
        Loss of TGH/Ces3 in mice decreases blood lipids, improves glucose tolerance, and increases energy expenditure.
        Cell Metab. 2010; 11: 183-193
        • Bertola A.
        • Mathews S.
        • Ki S.H.
        • Wang H.
        • Gao B.
        Mouse model of chronic and binge ethanol feeding (the NIAAA model).
        Nat Protoc. 2013; 8: 627-637
        • Chang B.
        • Xu M.J.
        • Zhou Z.
        • Cai Y.
        • Li M.
        • Wang W.
        • Feng D.
        • Bertola A.
        • Wang H.
        • Kunos G.
        • Gao B.
        Short- or long-term high-fat diet feeding plus acute ethanol binge synergistically induce acute liver injury in mice: an important role for CXCL1.
        Hepatology. 2015; 62: 1070-1085
        • Kaluzny M.A.
        • Duncan L.A.
        • Merritt M.V.
        • Epps D.E.
        Rapid separation of lipid classes in high yield and purity using bonded phase columns.
        J Lipid Res. 1985; 26: 135-140
        • Zhou Z.
        • Xu M.J.
        • Cai Y.
        • Wang W.
        • Jiang J.X.
        • Varga Z.V.
        • Feng D.
        • Pacher P.
        • Kunos G.
        • Torok N.J.
        • Gao B.
        Neutrophil-hepatic stellate cell interactions promote fibrosis in experimental steatohepatitis.
        Cell Mol Gastroenterol Hepatol. 2018; 5: 399-413

      Linked Article

      • Fatty Acid Ethyl Ethers: New Modulators of Acute Ethanol-Mediated Hepatotoxicity?
        Cellular and Molecular Gastroenterology and Hepatology
        • Preview
          Globally, rates of alcohol misuse are on the rise, including episodes of binge drinking as defined as more than 4–5 drinks on 1 occasion for women and men, respectively.1 The impact of heavy drinking can result in multiorgan damage, particularly leading to the development of alcohol-associated liver disease. Although the pattern of drinking (ie, binge) can influence alcohol-associated liver disease progression, the interactions of environment, genetics, and other comorbidities can further contribute to end-organ damage.
        • Full-Text
        • PDF
        Open Access