Advertisement

Intestinal Osteopontin Protects From Alcohol-induced Liver Injury by Preserving the Gut Microbiome and the Intestinal Barrier Function

Open AccessPublished:July 07, 2022DOI:https://doi.org/10.1016/j.jcmgh.2022.06.012

      Background & Aims

      The gut-liver axis plays a key role in the pathogenesis of alcohol-associated liver disease (ALD). We demonstrated that Opn-/- mice develop worse ALD than wild-type (WT) mice; however, the role of intestinal osteopontin (OPN) in ALD remains unknown. We hypothesized that overexpression of OPN in intestinal epithelial cells (IECs) could ameliorate ALD by preserving the gut microbiome and the intestinal barrier function.

      Methods

      OpnKI IEC, OpnΔIEC, and WT mice were fed the control or ethanol Lieber-DeCarli diet for 6 weeks.

      Results

      OpnKI IEC but not OpnΔIEC mice showed improved intestinal barrier function and protection from ALD. There were less pathogenic and more beneficial bacteria in ethanol-fed OpnKI IEC than in WT mice. Fecal microbiome transplant (FMT) from OpnKI IEC to WT mice protected from ALD. FMT from ethanol-fed WT to OpnKI IEC mice failed to induce ALD. Antimicrobial peptides, Il33, pSTAT3, aryl hydrocarbon receptor (Ahr), and tight-junction protein expression were higher in IECs from jejunum of ethanol-fed OpnKI IEC than of WT mice. Ethanol-fed OpnKI IEC showed more tryptophan metabolites and short-chain fatty acids in portal serum than WT mice. FMT from OpnKI IEC to WT mice enhanced IECs Ahr and tight-junction protein expression. Oral administration of milk OPN replicated the protective effect of OpnKI IEC mice in ALD.

      Conclusion

      Overexpression of OPN in IECs or administration of milk OPN maintain the intestinal microbiome by intestinal antimicrobial peptides. The increase in tryptophan metabolites and short-chain fatty acids signaling through the Ahr in IECs, preserve the intestinal barrier function and protect from ALD.

      Graphical abstract

      Keywords

      Abbreviations used in this paper:

      Ahr (aryl hydrocarbon receptor), ALD (alcohol-associated liver disease), ALT (alanine aminotransferase), AMPs (antimicrobial peptides), FITC-dextran (fluorescein isothiocyanate-dextran), FM (fecal microbiome), FMT (fecal microbiome transplant), H&E (hematoxylin and eosin), IECs (intestinal epithelial cells), Il1β (interleukin-1β), IM (intestinal microbiome), Jam4 (junctional adhesion molecule 4), JamA (junctional adhesion molecule A), KCs (Kupffer cells), LC/MS (liquid chromatography–mass spectrometry), LDC (Lieber-DeCarli), LPS (lipopolysaccharide), MFs (macrophages), mOPN (milk osteopontin), OPN (osteopontin), Reg (Regenerating islet-derived protein), SCFAs (short-chain fatty acids), TGs (triglycerides), TJ (tight-junction), Tnfα (tumor necrosis factor-α), Trp (tryptophan), WT (wild-type)
      Osteopontin protects from alcohol-associated liver disease by regulating the intestinal microbiome, which restores tryptophan metabolites and short-chain fatty acids signaling through aryl hydrocarbon receptor in intestinal epithelial cells. This preserves the integrity of the intestinal epithelial barrier and prevents bacterial translocation from the gut to the liver.
      Chronic alcohol consumption is a major cause of liver-related morbidity and mortality worldwide.
      • Ge X.
      • Lu Y.
      • Leung T.M.
      • Sorensen E.S.
      • Nieto N.
      Milk osteopontin, a nutritional approach to prevent alcohol-induced liver injury.
      ,
      • Ge X.
      • Leung T.M.
      • Arriazu E.
      • Lu Y.
      • Urtasun R.
      • Christensen B.
      • Fiel M.I.
      • Mochida S.
      • Sorensen E.S.
      • Nieto N.
      Osteopontin binding to lipopolysaccharide lowers tumor necrosis factor-alpha and prevents early alcohol-induced liver injury in mice.
      The gut-liver axis is a key player in alcohol-associated liver disease (ALD).
      • Szabo G.
      • Petrasek J.
      Gut-liver axis and sterile signals in the development of alcoholic liver disease.
      Alcohol and its metabolite acetaldehyde, disrupt the intestinal epithelial barrier.
      • Elamin E.
      • Jonkers D.
      • Juuti-Uusitalo K.
      • van Ijzendoorn S.
      • Troost F.
      • Duimel H.
      • Broers J.
      • Verheyen F.
      • Dekker J.
      • Masclee A.
      Effects of ethanol and acetaldehyde on tight junction integrity: in vitro study in a three dimensional intestinal epithelial cell culture model.
      Moreover, alcohol lowers the production of antimicrobial peptides (AMPs),
      • Wang L.
      • Fouts D.E.
      • Starkel P.
      • Hartmann P.
      • Chen P.
      • Llorente C.
      • DePew J.
      • Moncera K.
      • Ho S.B.
      • Brenner D.A.
      • Hooper L.V.
      • Schnabl B.
      Intestinal REG3 lectins protect against alcoholic steatohepatitis by reducing mucosa-associated microbiota and preventing bacterial translocation.
      ,
      • Hendrikx T.
      • Duan Y.
      • Wang Y.
      • Oh J.H.
      • Alexander L.M.
      • Huang W.
      • Starkel P.
      • Ho S.B.
      • Gao B.
      • Fiehn O.
      • Emond P.
      • Sokol H.
      • van Pijkeren J.P.
      • Schnabl B.
      Bacteria engineered to produce IL-22 in intestine induce expression of REG3G to reduce ethanol-induced liver disease in mice.
      causes intestinal dysbiosis – or changes in the composition and abundance of bacterial species – and bacterial overgrowth.
      • Wang L.
      • Fouts D.E.
      • Starkel P.
      • Hartmann P.
      • Chen P.
      • Llorente C.
      • DePew J.
      • Moncera K.
      • Ho S.B.
      • Brenner D.A.
      • Hooper L.V.
      • Schnabl B.
      Intestinal REG3 lectins protect against alcoholic steatohepatitis by reducing mucosa-associated microbiota and preventing bacterial translocation.
      Intestinal dysbiosis leads to global changes in intestinal metabolites, including branched-chain amino acids, such as tryptophan (Trp), short-chain fatty acids (SCFAs), and bile acids.
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      • Zhong W.
      • Zhou Z.
      Alterations of the gut microbiome and metabolome in alcoholic liver disease.
      As a result, there is disruption of the intestinal barrier, leaky gut, and translocation of bacteria and bacterial products from the intestinal lumen to the portal vein, which upon reaching the liver, activate Kupffer cells (KCs) and infiltrating macrophages (MFs) to trigger liver injury.
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      ,
      • Gao B.
      • Ahmad M.F.
      • Nagy L.E.
      • Tsukamoto H.
      Inflammatory pathways in alcoholic steatohepatitis.
      Osteopontin (OPN) (encoded by the Spp1 gene) is a soluble cytokine and a matrix-associated protein present in most tissues and body fluids.
      • Wang K.X.
      • Denhardt D.T.
      Osteopontin: role in immune regulation and stress responses.
      ,
      • Song Z.
      • Chen W.
      • Athavale D.
      • Ge X.
      • Desert R.
      • Das S.
      • Han H.
      • Nieto N.
      Osteopontin takes center stage in chronic liver disease.
      Serum and hepatic OPN increase in patients with alcoholic hepatitis and in animal models of ALD.
      • Morales-Ibanez O.
      • Dominguez M.
      • Ki S.H.
      • Marcos M.
      • Chaves J.F.
      • Nguyen-Khac E.
      • Houchi H.
      • Affo S.
      • Sancho-Bru P.
      • Altamirano J.
      • Michelena J.
      • Garcia-Pagan J.C.
      • Abraldes J.G.
      • Arroyo V.
      • Caballeria J.
      • Laso F.J.
      • Gao B.
      • Bataller R.
      Human and experimental evidence supporting a role for osteopontin in alcoholic hepatitis.
      ,
      • Patouraux S.
      • Bonnafous S.
      • Voican C.S.
      • Anty R.
      • Saint-Paul M.C.
      • Rosenthal-Allieri M.A.
      • Agostini H.
      • Njike M.
      • Barri-Ova N.
      • Naveau S.
      • Le Marchand-Brustel Y.
      • Veillon P.
      • Cales P.
      • Perlemuter G.
      • Tran A.
      • Gual P.
      The osteopontin level in liver, adipose tissue and serum is correlated with fibrosis in patients with alcoholic liver disease.
      Importantly, OPN is expressed in intestinal epithelial cells (IECs)
      • Nakase H.
      OPeNing the epithelial barrier: osteopontin preserves gut barrier function during intestinal inflammation.
      and maintains tight-junction (TJ) protein complexes, enabling occludin to localize to the TJs to be phosphorylated.
      • Nakase H.
      OPeNing the epithelial barrier: osteopontin preserves gut barrier function during intestinal inflammation.
      Furthermore, OPN maintains the homeostasis of intestinal commensal bacteria by preserving TCRγδ+ intraepithelial lymphocytes,
      • Ito K.
      • Nakajima A.
      • Fukushima Y.
      • Suzuki K.
      • Sakamoto K.
      • Hamazaki Y.
      • Ogasawara K.
      • Minato N.
      • Hattori M.
      The potential role of osteopontin in the maintenance of commensal bacteria homeostasis in the intestine.
      and acts as an opsonin to induce phagocytosis of bacteria.
      • Pedraza C.E.
      • Nikolcheva L.G.
      • Kaartinen M.T.
      • Barralet J.E.
      • McKee M.D.
      Osteopontin functions as an opsonin and facilitates phagocytosis by macrophages of hydroxyapatite-coated microspheres: implications for bone wound healing.
      Previous work from our laboratory demonstrated that overexpression of OPN in hepatocytes or treatment with milk osteopontin (mOPN) protected from ALD by blocking the gut-derived lipopolysaccharide (LPS) effects in the liver.
      • Ge X.
      • Leung T.M.
      • Arriazu E.
      • Lu Y.
      • Urtasun R.
      • Christensen B.
      • Fiel M.I.
      • Mochida S.
      • Sorensen E.S.
      • Nieto N.
      Osteopontin binding to lipopolysaccharide lowers tumor necrosis factor-alpha and prevents early alcohol-induced liver injury in mice.
      However, the role of IEC-derived OPN in ALD remains to be determined. We hypothesized that increasing the expression of OPN in IECs could preserve the gut-liver axis and protect from ALD. Thus, the aims of this work were, first, to compare the hepatoprotective effects of natural induction (due to alcohol) versus natural induction plus overexpression OPN in IECs; second, to analyze if enhanced expression of OPN in IECs could preserve the gut microbiome and the intestinal epithelial barrier function to protect from ALD; and third, to evaluate the therapeutic potential of oral administration of mOPN to maintain the gut microbial homeostasis under alcohol consumption.

      Results

      Ethanol Increases the Expression of OPN in IECs, Which Protects From ALD

      IECs express OPN,
      • Nakase H.
      OPeNing the epithelial barrier: osteopontin preserves gut barrier function during intestinal inflammation.
      and we previously demonstrated that ethanol drinking enhances the expression in mouse IECs.
      • Ge X.
      • Lu Y.
      • Leung T.M.
      • Sorensen E.S.
      • Nieto N.
      Milk osteopontin, a nutritional approach to prevent alcohol-induced liver injury.
      To further confirm this, we analyzed the mRNA expression of Opn in IECs of jejunum from wild-type (WT) mice fed control or ethanol Lieber-DeCarli (LDC) diet. Ethanol induced the expression of Opn mRNA in IECs (Figure 1, A). To evaluate the role of the increased expression of OPN in IECs in ALD, male and female OpnKI IEC and WT mice were fed control or ethanol diet for 6 weeks. Hematoxylin and eosin (H&E) staining of formalin-fixed paraffin-embedded liver sections (Figure 1, B), the steatosis and inflammation scores, liver triglycerides (TGs) and serum alanine aminotransferase (ALT) activity (Figure 1, C) showed less ethanol-induced liver injury in OpnKI IEC than in WT mice. To determine if ablating Opn in IECs could worsen ALD, male and female OpnΔIEC and WT mice were fed control or ethanol diet for 6 weeks. The H&E staining (Figure 1, D), the steatosis and inflammation scores, liver TGs and serum ALT activity (Figure 1, E) revealed increased liver injury in ethanol-fed OpnΔIEC compared with WT mice. The duodenum, jejunum, ileum, and colon from these mice did not show structural changes after ethanol feeding (not shown). These findings indicate that increasing the expression of OPN in IECs protects from ALD.
      Figure thumbnail gr1ab
      Figure 1Ethanol increases the expression of OPN in IECs, which protects from ALD. WT mice were fed the control or ethanol diet for 6 weeks to provoke ALD. Opn mRNA expression was measured in IECs isolated from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against control. N = 8 (4 males + 4 females)/group; ∗∗∗P < .001 vs control (A). WT and OpnKI IEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (B). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, and serum alcohol levels n = 6/group, data are expressed as mean ± standard error of themean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; ˆP < .05 and ˆˆP < .01 vs WT ethanol (C). WT and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (D). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, and serum alcohol levels. N = 6/group, data are expressed as mean ± standard error of the mean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .05 vs WT control. C, Control diet; E, ethanol diet (E).
      Figure thumbnail gr1ce
      Figure 1Ethanol increases the expression of OPN in IECs, which protects from ALD. WT mice were fed the control or ethanol diet for 6 weeks to provoke ALD. Opn mRNA expression was measured in IECs isolated from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against control. N = 8 (4 males + 4 females)/group; ∗∗∗P < .001 vs control (A). WT and OpnKI IEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (B). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, and serum alcohol levels n = 6/group, data are expressed as mean ± standard error of themean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; ˆP < .05 and ˆˆP < .01 vs WT ethanol (C). WT and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (D). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, and serum alcohol levels. N = 6/group, data are expressed as mean ± standard error of the mean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .05 vs WT control. C, Control diet; E, ethanol diet (E).

      The Increased Expression of OPN in IECs Preserves Gut Permeability

      Because leaky gut contributes to the pathogenesis of ALD,
      • Szabo G.
      • Petrasek J.
      Gut-liver axis and sterile signals in the development of alcoholic liver disease.
      ,
      • Wang H.
      • Zhou H.
      • Zhang Q.
      • Poulsen K.L.
      • Taylor V.
      • McMullen M.R.
      • Czarnecki D.
      • Dasarathy D.
      • Yu M.
      • Liao Y.
      • Allende D.S.
      • Chen X.
      • Hong L.
      • Zhao J.
      • Yang J.
      • Nagy L.E.
      • Li X.
      Inhibition of IRAK4 kinase activity improves ethanol-induced liver injury in mice.
      we measured gut permeability in these mice. As shown in Figure 2, A, portal serum fluorescein isothiocyanate-dextran (FITC-dextran) was lower in ethanol-fed OpnKI IEC than in WT mice. Ethanol-fed WT and OpnΔIEC mice showed similar increase in portal serum FITC-dextran compared with their respective control-fed group (Figure 2, B). To determine if these changes in gut permeability led to translocation of bacterial products and bacteria from the gut lumen to the portal vein and the liver, we measured the concentration of portal serum LPS and bacterial 16S rRNA in the liver. Ethanol-fed OpnKI IEC showed lower LPS and bacterial 16S rRNA than WT mice (Figure 2, C–D). However, hepatic bacterial 16S rRNA was equally higher in ethanol-fed WT and OpnΔIEC mice compared with their respective control-fed group (Figure 2, E). To assess if protection from ALD was due to reduced KC activation, as well as inflammatory cell infiltration and activation, we measured the mRNA expression of pro-inflammatory cytokines in the liver. Ethanol-fed OpnKI IEC showed lower tumor necrosis factor-α (Tnfa), Il1b, Ccl2, and Ccl3 mRNAs than WT mice (Figure 2, F) bur remained comparably high in ethanol-fed WT and OpnΔIEC mice (Figure 2, G). Overall, these results suggest that overexpression of OPN in IECs preserves the intestinal epithelial barrier function, prevents translocation of LPS, and reduces KC activation and the production of pro-inflammatory cytokines, all of which protect from ALD.
      Figure thumbnail gr2ae
      Figure 2The increased expression of OPN in IECs preserves gut permeability. WT, OpnKI IEC and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. Portal serum FITC-dextran (A–B). Portal serum LPS (C). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene and fold change (FC) was calculated against WT control (D–E). mRNA expression of pro-inflammatory cytokines in the liver. Data were normalized with β-actin as housekeeping gene and FC was calculated against WT control (F–G). n = 6/group; data are presented as mean ± standard error of the mean. P < .05 and ∗∗P < .01 vs control; ˆP < .05 and ˆˆP < .01 vs WT ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr2fg
      Figure 2The increased expression of OPN in IECs preserves gut permeability. WT, OpnKI IEC and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. Portal serum FITC-dextran (A–B). Portal serum LPS (C). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene and fold change (FC) was calculated against WT control (D–E). mRNA expression of pro-inflammatory cytokines in the liver. Data were normalized with β-actin as housekeeping gene and FC was calculated against WT control (F–G). n = 6/group; data are presented as mean ± standard error of the mean. P < .05 and ∗∗P < .01 vs control; ˆP < .05 and ˆˆP < .01 vs WT ethanol. C, Control diet; E, ethanol diet.

      The Increased Expression of OPN in IECs Prevents Alcohol-induced Dysbiosis

      Alcohol drinking causes intestinal dysbiosis, which disrupts the gut barrier and contributes to ALD.
      • Szabo G.
      • Petrasek J.
      Gut-liver axis and sterile signals in the development of alcoholic liver disease.
      ,
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      Thus, we examined if ethanol-fed OpnKI IEC mice were protected from alcohol-induced intestinal dysbiosis by analyzing the fecal microbiome (FM). The abundance of total bacteria was similar among groups of mice (Figure 3, A). The Shannon diversity index (alpha diversity) was higher in ethanol-fed than in control-fed OpnKI IEC mice, indicating a diverse and equally distributed microbiome in ethanol-fed OpnKI IEC mice (Figure 3, B). Weighted UniFrac analysis (beta diversity) revealed that the fecal bacteria in ethanol-fed OpnKI IEC was different from WT but was comparable to control-fed OpnKI IEC and WT mice (Figure 3, C). Eight bacterial phyla were most dominant in all groups of mice (Figure 3, D). The abundance of these phyla (Bacteroidetes, Firmicutes, Proteobacteria, Actinobacteria, Acidobacteria, Tenericutes, Deferribacteres) was similar in ethanol-fed and control-fed OpnKI IEC but increased in ethanol-fed compared with control-fed WT mice, except for Deferribacteres, which decreased (Figure 3, E). Differential analysis of bacterial genera (Figure 3, F), showed that 36 genera, including Bacteroides, Escherichia, Enterococcus, and Aerococcus, all pathogenic and increased in ALD, were higher in ethanol-fed WT than in OpnKI IEC mice (Figure 3, G). Twenty-two genera, including Bifidobacterium, Eubacterium, Prevotella, and Alloprevotella, linked to intestinal Trp and SCFAs metabolism and known to be beneficial, were higher in ethanol-fed OpnKI IEC than in WT mice (Figure 3, H). Overall, these findings suggest that OpnKI IEC mice are protected from alcohol-induced intestinal dysbiosis.
      Figure thumbnail gr3ad
      Figure 3The increased expression of OPN in IECs prevents alcohol-induced dysbiosis. WT and OpnKI IEC mice were fed control or ethanol diet for 6 weeks to provoke ALD; then, 16S rRNA sequencing was performed in stools to analyze the FM. Total bacterial abundance (A). Shannon index for alpha diversity (B). Principal component analysis plot of weighted UniFrac distances for beta diversity (C). Operational taxonomic unit (%) of bacterial phyla (D). Differential analysis of bacterial phyla (E). Volcano plot of bacterial genera (F). Highly abundant bacterial genera in ethanol-fed WT (G) and in ethanol-fed OpnKI IEC (H) mice. N = 8 (4 males + 4 females)/group. XXP < .05 vs control; false discovery rate (FDR) <0.05; ∗∗FDR <0.01; and ∗∗∗FDR <0.001 vs control; ˆFDR <0.05; ˆˆFDR <0.01; and ˆˆˆFDR <0.001 vs WT ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr3e
      Figure 3The increased expression of OPN in IECs prevents alcohol-induced dysbiosis. WT and OpnKI IEC mice were fed control or ethanol diet for 6 weeks to provoke ALD; then, 16S rRNA sequencing was performed in stools to analyze the FM. Total bacterial abundance (A). Shannon index for alpha diversity (B). Principal component analysis plot of weighted UniFrac distances for beta diversity (C). Operational taxonomic unit (%) of bacterial phyla (D). Differential analysis of bacterial phyla (E). Volcano plot of bacterial genera (F). Highly abundant bacterial genera in ethanol-fed WT (G) and in ethanol-fed OpnKI IEC (H) mice. N = 8 (4 males + 4 females)/group. XXP < .05 vs control; false discovery rate (FDR) <0.05; ∗∗FDR <0.01; and ∗∗∗FDR <0.001 vs control; ˆFDR <0.05; ˆˆFDR <0.01; and ˆˆˆFDR <0.001 vs WT ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr3fh
      Figure 3The increased expression of OPN in IECs prevents alcohol-induced dysbiosis. WT and OpnKI IEC mice were fed control or ethanol diet for 6 weeks to provoke ALD; then, 16S rRNA sequencing was performed in stools to analyze the FM. Total bacterial abundance (A). Shannon index for alpha diversity (B). Principal component analysis plot of weighted UniFrac distances for beta diversity (C). Operational taxonomic unit (%) of bacterial phyla (D). Differential analysis of bacterial phyla (E). Volcano plot of bacterial genera (F). Highly abundant bacterial genera in ethanol-fed WT (G) and in ethanol-fed OpnKI IEC (H) mice. N = 8 (4 males + 4 females)/group. XXP < .05 vs control; false discovery rate (FDR) <0.05; ∗∗FDR <0.01; and ∗∗∗FDR <0.001 vs control; ˆFDR <0.05; ˆˆFDR <0.01; and ˆˆˆFDR <0.001 vs WT ethanol. C, Control diet; E, ethanol diet.

      The Intestinal Microbiome (IM) From OpnKI IEC Mice Protects From ALD

      To determine if the IM from OpnKI IEC protects from ALD, we transplanted FM from OpnKI IEC to WT mice and fed them with control or ethanol diet for 6 weeks. H&E staining (Figure 4, A), the steatosis and inflammation scores, liver TGs, and serum ALT activity (Figure 4, B) showed less alcohol-induced liver injury in WT after fecal microbiome transplant (FMT) from OpnKI IEC mice compared with mice without FMT. The increase in portal serum FITC-dextran in ethanol-fed WT mice was prevented by FMT from OpnKI IEC mice (Figure 4, B). Ethanol-fed WT mice with FMT from OpnKI IEC mice showed lower bacterial 16S rRNA (Figure 4, C), and decreased the mRNA expression of pro-inflammatory cytokines (Tnfa, Il1b, Ccl2, Ccl3) in liver compared with mice without FMT (Figure 4, D). The duodenum, jejunum, ileum, and colon from these mice did not show structural changes after FMT and ethanol feeding (not shown). These data indicate that the IM from OpnKI IEC mice improves intestinal epithelial barrier function, lowers hepatic pro-inflammatory cytokines, and protects from ALD.
      Figure thumbnail gr4
      Figure 4The IM from OpnKI IEC mice protects from ALD. WT mice were transplanted with FM from OpnKI IEC and were fed control or ethanol diet for 6 weeks to provoke ALD. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (A). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (B). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene and fold change (FC) was calculated against no-FMT control (C). mRNA expression of hepatic pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene and FC was calculated against no-FMT control (D). n = 4/group; data are expressed as mean ± standard error of the mean. P < .05 and ∗∗∗P < .001 vs control; ˆP < .05 vs no-FMT ethanol. C, Control diet; E, ethanol diet.

      Overexpression of OPN in IECs Preserves the IM and Protects From ALD

      To examine if overexpression of OPN in IECs changes the IM in OpnKI IEC mice, we performed FMT from ethanol-fed WT mice to OpnKI IEC mice and fed them with control or ethanol diet for 6 weeks to provoke ALD. FM analysis showed that 8 bacterial phyla were the most prevalent in these mice (Figure 5, A). Ethanol-fed OpnKI IEC mice with FMT from ethanol-fed WT mice showed higher total bacteria and alpha diversity compared with ethanol-fed WT mice with FMT from ethanol-fed WT mice (Figure 5, B–C). The beta diversity analysis showed that the IM in ethanol-fed OpnKI IEC mice with FMT from ethanol-fed WT mice was different from that of ethanol-fed WT mice with FMT from ethanol-fed WT mice (Figure 5, D). These results suggest that overexpression of OPN in IECs regulates the IM. To assess if the OPN-mediated regulation of the IM protects from ALD, we evaluated liver injury. H&E staining (Figure 5, E), the steatosis and inflammation scores, liver TGs, and serum ALT activity (Figure 5, F) demonstrated less liver injury in ethanol-fed OpnKI IEC mice with FMT from ethanol-fed WT mice compared with ethanol-fed WT mice with FMT from ethanol-fed WT mice. The former showed decreased portal serum FITC-dextran, less bacterial 16S rRNA in liver, and lower hepatic mRNA expression of Tnfa, Il1b, Ccl2, and Ccl3, compared with the latter (Figure 5, F–H), indicating improved gut barrier function in OpnKI IEC mice. The duodenum, jejunum, ileum, and colon from these mice did not show structural changes (not shown). Thus, these results indicate that overexpression of OPN in IECs preserves the gut microbiome, the intestinal epithelial barrier function, and protects from ALD.
      Figure thumbnail gr5ad
      Figure 5Overexpression of OPN in IECs preserves the gut microbiome and protects from ALD. FM from 6-week ethanol-fed WT mice were transplanted to WT and OpnKI IEC mice, and then they were fed the control or ethanol diet for 6 weeks to provoke ALD. 16S rRNA sequencing was performed to analyze the FM. Operational taxonomic unit (%) of bacterial phyla (A). Total bacterial abundance (B). Shannon Index for alpha diversity (C). Principal component analysis plot of weighted UniFrac distances for beta diversity (D). Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (E). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (F). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene and fold change (FC) was calculated against WT control (G). Hepatic mRNA expression of pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene, and FC was calculated against WT control (H). N = 3–4/group; data are expressed as mean ± standard error of the mean. P < .05 and ∗∗∗P < .001 vs control; #P < .05 vs WT control; ˆP < .05 vs WT ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr5eh
      Figure 5Overexpression of OPN in IECs preserves the gut microbiome and protects from ALD. FM from 6-week ethanol-fed WT mice were transplanted to WT and OpnKI IEC mice, and then they were fed the control or ethanol diet for 6 weeks to provoke ALD. 16S rRNA sequencing was performed to analyze the FM. Operational taxonomic unit (%) of bacterial phyla (A). Total bacterial abundance (B). Shannon Index for alpha diversity (C). Principal component analysis plot of weighted UniFrac distances for beta diversity (D). Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (E). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (F). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene and fold change (FC) was calculated against WT control (G). Hepatic mRNA expression of pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene, and FC was calculated against WT control (H). N = 3–4/group; data are expressed as mean ± standard error of the mean. P < .05 and ∗∗∗P < .001 vs control; #P < .05 vs WT control; ˆP < .05 vs WT ethanol. C, Control diet; E, ethanol diet.

      OPN Preserves the Gut Microbiome by Inducing AMPs Expression in IECs, Which Maintain the Intestinal Barrier Function and Protect From ALD

      To understand how IEC-derived OPN preserves the gut microbiome upon alcohol exposure, we examined the expression of AMPs in IECs from jejunum. Regenerating islet-derived protein (Reg) 3β and mRNA and protein were higher in IECs from ethanol-fed OpnKI IEC mice than in WT mice (Figure 6, A–B). Interleukin-33 (Il33) and phosphorylation of STAT3, known to enhance AMPs in IECs,
      • Xiao Y.
      • Huang X.
      • Zhao Y.
      • Chen F.
      • Sun M.
      • Yang W.
      • Chen L.
      • Yao S.
      • Peniche A.
      • Dann S.M.
      • Sun J.
      • Golovko G.
      • Fofanov Y.
      • Miao Y.
      • Liu Z.
      • Chen D.
      • Cong Y.
      Interleukin-33 promotes REG3gamma expression in intestinal epithelial cells and regulates gut microbiota.
      were higher in jejunal IECs from control and ethanol-fed OpnKI IEC mice, whereas Il33 was higher only in jejunal IECs from ethanol-fed OpnKI IEC mice (Figure 6, A and C). To determine if the effect of OPN in the gut microbiome preserved the intestinal barrier function, first we measured portal serum Trp metabolites and SCFAs, produced by the gut microbiome, and known to improve gut barrier function.
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      ,
      • Liu P.
      • Wang Y.
      • Yang G.
      • Zhang Q.
      • Meng L.
      • Xin Y.
      • Jiang X.
      The role of short-chain fatty acids in intestinal barrier function, inflammation, oxidative stress, and colonic carcinogenesis.
      Second, we evaluated the mRNA expression of aryl hydrocarbon receptor (Ahr), which regulates gut barrier function via Trp metabolites
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      and SCFAs.
      • Jin U.H.
      • Cheng Y.
      • Park H.
      • Davidson L.A.
      • Callaway E.S.
      • Chapkin R.S.
      • Jayaraman A.
      • Asante A.
      • Allred C.
      • Weaver E.A.
      • Safe S.
      Short chain fatty acids enhance aryl hydrocarbon (Ah) responsiveness in mouse colonocytes and Caco-2 human colon cancer cells.
      Third, we analyzed mRNA expression of TJ proteins in IECs from jejunum. Trp, indole metabolites, and SCFAs increased in portal serum from ethanol-fed OpnKI IEC mice compared with WT mice (Figure 6, D–G). Ethanol-fed OpnKI IEC mice showed higher Ahr, Occludin, junctional adhesion molecule A (JamA), and junctional adhesion molecule 4 (Jam4) mRNA expression in IECs from jejunum than in WT mice (Figure 6, H). AHR protein expression was similar in IECs from jejunum in control and ethanol-fed OpnKI IEC mice (Figure 6, B).
      Figure thumbnail gr6ac
      Figure 6OPN preserves the gut microbiome by inducing AMPs expression in IECs, which maintains the intestinal barrier function and protects from ALD. WT and OpnKI IEC mice were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, and Il33 in IECs isolated from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males + 3 females]/group) (A). Western blot of REG3G and total AHR in IECs isolated from jejunum (n = 3 males/group) (B). Western blot of STAT3 and pSTAT3 in IECs isolated from jejunum (n = 3 males/group) (C). Levels of Trp, its metabolites kynureine and indole metabolites (3-indoleacetic acid + 3-indoleacrylic acid + 3-indolepropionic acid + 3-indoxyl sulfate + indole + indole-3-lactic acid + tryptamine + tryptophol) in portal serum (n = 3 males/group) (D–E). Levels of SCFAs (acetic acid + propionic acid + butyric acid) in portal serum (n = 3 males/group) (F–G). mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males +3 females]/group) (H). Data are expressed as mean ± standard error of the mean (SEM). P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .01 vs WT control; ˆP < .05; ˆˆP < .01; and ˆˆˆP < .01 vs WT ethanol. WT and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, Il33, Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against WT control. N = 6 (3 males + 3 females)/group; data are expressed as mean ± SEM (I). WT mice were transplanted with FM from OpnKI IEC and were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and FC was calculated against no-FMT control (n = 4/group) (J). Western blot of total, cytosolic, and nuclear Ahr in IECs from jejunum (n = 3/group) (K). Data are expressed as mean ± SEM. P < .05 and ∗∗P < .01 vs control; ˆP < .05 vs no-FMT ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr6de
      Figure 6OPN preserves the gut microbiome by inducing AMPs expression in IECs, which maintains the intestinal barrier function and protects from ALD. WT and OpnKI IEC mice were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, and Il33 in IECs isolated from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males + 3 females]/group) (A). Western blot of REG3G and total AHR in IECs isolated from jejunum (n = 3 males/group) (B). Western blot of STAT3 and pSTAT3 in IECs isolated from jejunum (n = 3 males/group) (C). Levels of Trp, its metabolites kynureine and indole metabolites (3-indoleacetic acid + 3-indoleacrylic acid + 3-indolepropionic acid + 3-indoxyl sulfate + indole + indole-3-lactic acid + tryptamine + tryptophol) in portal serum (n = 3 males/group) (D–E). Levels of SCFAs (acetic acid + propionic acid + butyric acid) in portal serum (n = 3 males/group) (F–G). mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males +3 females]/group) (H). Data are expressed as mean ± standard error of the mean (SEM). P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .01 vs WT control; ˆP < .05; ˆˆP < .01; and ˆˆˆP < .01 vs WT ethanol. WT and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, Il33, Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against WT control. N = 6 (3 males + 3 females)/group; data are expressed as mean ± SEM (I). WT mice were transplanted with FM from OpnKI IEC and were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and FC was calculated against no-FMT control (n = 4/group) (J). Western blot of total, cytosolic, and nuclear Ahr in IECs from jejunum (n = 3/group) (K). Data are expressed as mean ± SEM. P < .05 and ∗∗P < .01 vs control; ˆP < .05 vs no-FMT ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr6fi
      Figure 6OPN preserves the gut microbiome by inducing AMPs expression in IECs, which maintains the intestinal barrier function and protects from ALD. WT and OpnKI IEC mice were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, and Il33 in IECs isolated from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males + 3 females]/group) (A). Western blot of REG3G and total AHR in IECs isolated from jejunum (n = 3 males/group) (B). Western blot of STAT3 and pSTAT3 in IECs isolated from jejunum (n = 3 males/group) (C). Levels of Trp, its metabolites kynureine and indole metabolites (3-indoleacetic acid + 3-indoleacrylic acid + 3-indolepropionic acid + 3-indoxyl sulfate + indole + indole-3-lactic acid + tryptamine + tryptophol) in portal serum (n = 3 males/group) (D–E). Levels of SCFAs (acetic acid + propionic acid + butyric acid) in portal serum (n = 3 males/group) (F–G). mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males +3 females]/group) (H). Data are expressed as mean ± standard error of the mean (SEM). P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .01 vs WT control; ˆP < .05; ˆˆP < .01; and ˆˆˆP < .01 vs WT ethanol. WT and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, Il33, Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against WT control. N = 6 (3 males + 3 females)/group; data are expressed as mean ± SEM (I). WT mice were transplanted with FM from OpnKI IEC and were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and FC was calculated against no-FMT control (n = 4/group) (J). Western blot of total, cytosolic, and nuclear Ahr in IECs from jejunum (n = 3/group) (K). Data are expressed as mean ± SEM. P < .05 and ∗∗P < .01 vs control; ˆP < .05 vs no-FMT ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr6jk
      Figure 6OPN preserves the gut microbiome by inducing AMPs expression in IECs, which maintains the intestinal barrier function and protects from ALD. WT and OpnKI IEC mice were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, and Il33 in IECs isolated from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males + 3 females]/group) (A). Western blot of REG3G and total AHR in IECs isolated from jejunum (n = 3 males/group) (B). Western blot of STAT3 and pSTAT3 in IECs isolated from jejunum (n = 3 males/group) (C). Levels of Trp, its metabolites kynureine and indole metabolites (3-indoleacetic acid + 3-indoleacrylic acid + 3-indolepropionic acid + 3-indoxyl sulfate + indole + indole-3-lactic acid + tryptamine + tryptophol) in portal serum (n = 3 males/group) (D–E). Levels of SCFAs (acetic acid + propionic acid + butyric acid) in portal serum (n = 3 males/group) (F–G). mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene and fold change (FC) was calculated against WT control (n = 6 [3 males +3 females]/group) (H). Data are expressed as mean ± standard error of the mean (SEM). P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .01 vs WT control; ˆP < .05; ˆˆP < .01; and ˆˆˆP < .01 vs WT ethanol. WT and OpnΔIEC mice were fed control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Reg3β, Reg3γ, Il33, Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against WT control. N = 6 (3 males + 3 females)/group; data are expressed as mean ± SEM (I). WT mice were transplanted with FM from OpnKI IEC and were fed the control or ethanol diet for 6 weeks to provoke ALD. mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and FC was calculated against no-FMT control (n = 4/group) (J). Western blot of total, cytosolic, and nuclear Ahr in IECs from jejunum (n = 3/group) (K). Data are expressed as mean ± SEM. P < .05 and ∗∗P < .01 vs control; ˆP < .05 vs no-FMT ethanol. C, Control diet; E, ethanol diet.
      Next, to establish the link among OPN, Ahr, and TJ proteins, the mRNA expression of AMPs (Reg3β and Reg3γ), Il33, Ahr, and TJ proteins (Occludin, Claudin3, JamA, Jam4) were analyzed in IECs from jejunum of OpnΔIEC and WT mice fed control or ethanol diet for 6 weeks. OpnΔIEC mice did not show meaningful changes in Reg3β, Reg3γ, Il33, Ahr, Occludin, Claudin3, JamA, and Jam4 after ethanol feeding (Figure 6, I). To confirm that the FM from OpnKI IEC mice preserved the intestinal barrier function, the expression of Ahr, Occludin, Claudin3, JamA, and Jam4 was measured in IECs from jejunum of WT mice with FMT from OpnKI IEC mice. Ethanol-fed WT mice with FMT from OpnKI IEC showed higher mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 compared with ethanol-fed WT mice with no FMT (Figure 6, J). Analysis of total, cytosolic, and nuclear protein revealed that ethanol lowered AHR expression in IECs from jejunum and that FMT from OpnKI IEC mice preserved protein expression (Figure 6, K). These data indicate that overexpression of OPN in IECs increases intestinal AMPs to maintain the gut microbiome, which maintains intestinal barrier function via Trp metabolites, SCFAs, and Ahr, all of which protect OpnKI IEC mice from ALD.

      Oral Administration of mOPN maintains the gut microbiome and protects from ALD

      Our previous report proved that oral administration of mOPN during chronic ethanol feeding ameliorates ALD.
      • Ge X.
      • Lu Y.
      • Leung T.M.
      • Sorensen E.S.
      • Nieto N.
      Milk osteopontin, a nutritional approach to prevent alcohol-induced liver injury.
      To dissect if this occurred by preserving the gut microbiome, we performed FMT from ethanol-fed WT mice to WT mice and fed them with control or ethanol diet for 6 weeks in the presence or absence of mOPN. The H&E staining (Figure 7, A), the steatosis and inflammation scores, liver TGs, serum ALT activity, portal serum FITC-dextran (Figure 7, B), hepatic bacterial 16S rRNA (Figure 7, C), and hepatic mRNA expression of pro-inflammatory cytokines (Figure 7, D) revealed less liver injury in ethanol-fed WT mice with oral administration of mOPN in the presence or absence of FMT from ethanol-fed WT mice. The duodenum, jejunum, ileum, and colon from these mice did not show structural changes (not shown). To understand if protection from ALD by mOPN was mediated by preserving the gut microbiome, we analyzed the FM from WT mice fed the control or ethanol diet in the presence or absence of mOPN. The abundance of total bacteria and alpha diversity was higher in ethanol-fed WT mice with mOPN than in mice without mOPN (Figure 7, E–F), suggesting that mOPN maintains a rich, diverse, and equally distributed microbiome. Analysis of beta diversity showed that the fecal bacteria in mOPN plus ethanol-fed WT mice was different than that without mOPN but was comparable to control-fed WT mice with or without mOPN (Figure 7, G). Eight bacterial phyla were most abundant in mice with or without mOPN (Figure 7, H). Differential analysis of the bacterial genera (Figure 7, I) showed that chronic ethanol feeding without mOPN promoted the growth of pathogenic genera, such as Bacteroides, Alistipes, and Enterococcus (Figure 7, J). However, mOPN promoted the growth of bacteria, such as Bifidobacterium, Eubacterium, Desulfovibrio, Butyricicoccus, Butyricimonas, and Roseburia, linked to intestinal Trp and SCFAs metabolism (Figure 7, J), which play a beneficial role in the gut.
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      ,
      • Rosser E.C.
      • Piper C.J.M.
      • Matei D.E.
      • Blair P.A.
      • Rendeiro A.F.
      • Orford M.
      • Alber D.G.
      • Krausgruber T.
      • Catalan D.
      • Klein N.
      • Manson J.J.
      • Drozdov I.
      • Bock C.
      • Wedderburn L.R.
      • Eaton S.
      • Mauri C.
      Microbiota-derived metabolites suppress arthritis by amplifying aryl-hydrocarbon receptor activation in regulatory B cells.
      • Parada Venegas D.
      • De la Fuente M.K.
      • Landskron G.
      • Gonzalez M.J.
      • Quera R.
      • Dijkstra G.
      • Harmsen H.J.M.
      • Faber K.N.
      • Hermoso M.A.
      Short chain fatty acids (SCFAs)-mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases.
      • Liu J.
      • Yue S.
      • Yang Z.
      • Feng W.
      • Meng X.
      • Wang A.
      • Peng C.
      • Wang C.
      • Yan D.
      Oral hydroxysafflor yellow A reduces obesity in mice by modulating the gut microbiota and serum metabolism.
      These findings suggest that mOPN protects from ALD by preserving the gut microbiome.
      Figure thumbnail gr7a
      Figure 7Oral administration of mOPN preserves the gut microbiome and protects from ALD. FM from 6-week ethanol-fed WT mice was transplanted to WT mice, and then mice were fed the control or ethanol diet for 6 weeks in the presence or absence of mOPN. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (A). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (B). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene, and fold change (FC) was calculated against WT control (I). Liver mRNA expression of pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene, and FC was calculated against WT control (D). Total bacterial abundance (E). Shannon Index for alpha diversity (F). Principal components analysis plot of weighted UniFrac distances for beta diversity (G). Operational taxonomic unit (%) of bacterial phyla (H). Volcano plot of bacterial genera (I). Differential analysis of bacterial genera (J). n = 4/group; data are presented as mean ± standard error of the mean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .05 vs no-FMT control; P < .05 vs FMT control; ˆP < .05 vs no-FMT ethanol; $P < .05 and $$P < .01 vs FMT ethanol. ξP < .05 vs without mOPN ethanol. ¤False discovery rate (FDR) <0.05; ¤¤FDR <0.01; and ¤¤¤FDR <0.001 vs without mOPN ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr7bd
      Figure 7Oral administration of mOPN preserves the gut microbiome and protects from ALD. FM from 6-week ethanol-fed WT mice was transplanted to WT mice, and then mice were fed the control or ethanol diet for 6 weeks in the presence or absence of mOPN. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (A). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (B). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene, and fold change (FC) was calculated against WT control (I). Liver mRNA expression of pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene, and FC was calculated against WT control (D). Total bacterial abundance (E). Shannon Index for alpha diversity (F). Principal components analysis plot of weighted UniFrac distances for beta diversity (G). Operational taxonomic unit (%) of bacterial phyla (H). Volcano plot of bacterial genera (I). Differential analysis of bacterial genera (J). n = 4/group; data are presented as mean ± standard error of the mean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .05 vs no-FMT control; P < .05 vs FMT control; ˆP < .05 vs no-FMT ethanol; $P < .05 and $$P < .01 vs FMT ethanol. ξP < .05 vs without mOPN ethanol. ¤False discovery rate (FDR) <0.05; ¤¤FDR <0.01; and ¤¤¤FDR <0.001 vs without mOPN ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr7eg
      Figure 7Oral administration of mOPN preserves the gut microbiome and protects from ALD. FM from 6-week ethanol-fed WT mice was transplanted to WT mice, and then mice were fed the control or ethanol diet for 6 weeks in the presence or absence of mOPN. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (A). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (B). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene, and fold change (FC) was calculated against WT control (I). Liver mRNA expression of pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene, and FC was calculated against WT control (D). Total bacterial abundance (E). Shannon Index for alpha diversity (F). Principal components analysis plot of weighted UniFrac distances for beta diversity (G). Operational taxonomic unit (%) of bacterial phyla (H). Volcano plot of bacterial genera (I). Differential analysis of bacterial genera (J). n = 4/group; data are presented as mean ± standard error of the mean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .05 vs no-FMT control; P < .05 vs FMT control; ˆP < .05 vs no-FMT ethanol; $P < .05 and $$P < .01 vs FMT ethanol. ξP < .05 vs without mOPN ethanol. ¤False discovery rate (FDR) <0.05; ¤¤FDR <0.01; and ¤¤¤FDR <0.001 vs without mOPN ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr7hi
      Figure 7Oral administration of mOPN preserves the gut microbiome and protects from ALD. FM from 6-week ethanol-fed WT mice was transplanted to WT mice, and then mice were fed the control or ethanol diet for 6 weeks in the presence or absence of mOPN. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (A). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (B). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene, and fold change (FC) was calculated against WT control (I). Liver mRNA expression of pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene, and FC was calculated against WT control (D). Total bacterial abundance (E). Shannon Index for alpha diversity (F). Principal components analysis plot of weighted UniFrac distances for beta diversity (G). Operational taxonomic unit (%) of bacterial phyla (H). Volcano plot of bacterial genera (I). Differential analysis of bacterial genera (J). n = 4/group; data are presented as mean ± standard error of the mean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .05 vs no-FMT control; P < .05 vs FMT control; ˆP < .05 vs no-FMT ethanol; $P < .05 and $$P < .01 vs FMT ethanol. ξP < .05 vs without mOPN ethanol. ¤False discovery rate (FDR) <0.05; ¤¤FDR <0.01; and ¤¤¤FDR <0.001 vs without mOPN ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr7j
      Figure 7Oral administration of mOPN preserves the gut microbiome and protects from ALD. FM from 6-week ethanol-fed WT mice was transplanted to WT mice, and then mice were fed the control or ethanol diet for 6 weeks in the presence or absence of mOPN. Liver H&E staining (green arrows, macrovesicular steatosis; yellow arrows, microvesicular steatosis; red arrows, inflammatory foci; CV, central vein; PV, portal vein) (A). Body weight, liver weight, liver to body weight ratio, pathology scores, liver TGs, serum ALT activity, serum alcohol levels, and portal serum FITC-dextran (B). Hepatic bacterial 16S rRNA. Data were normalized with 18S as housekeeping gene, and fold change (FC) was calculated against WT control (I). Liver mRNA expression of pro-inflammatory cytokines. Data were normalized with β-actin as housekeeping gene, and FC was calculated against WT control (D). Total bacterial abundance (E). Shannon Index for alpha diversity (F). Principal components analysis plot of weighted UniFrac distances for beta diversity (G). Operational taxonomic unit (%) of bacterial phyla (H). Volcano plot of bacterial genera (I). Differential analysis of bacterial genera (J). n = 4/group; data are presented as mean ± standard error of the mean. P < .05; ∗∗P < .01; and ∗∗∗P < .001 vs control; #P < .05 vs no-FMT control; P < .05 vs FMT control; ˆP < .05 vs no-FMT ethanol; $P < .05 and $$P < .01 vs FMT ethanol. ξP < .05 vs without mOPN ethanol. ¤False discovery rate (FDR) <0.05; ¤¤FDR <0.01; and ¤¤¤FDR <0.001 vs without mOPN ethanol. C, Control diet; E, ethanol diet.

      Oral Administration of mOPN Induces AMPs in IECs, Which Preserve the Gut Microbiota and the Intestinal Barrier Function

      To understand if mOPN preserves the gut microbiome by inducing AMPs in IECs, we analyzed the expression of Reg 3β, Reg 3γ, and Il33 in IECs from jejunum. Chronic ethanol feeding lowered Reg3β, Reg3γ, and Il33 mRNAs, and mOPN induced them in IECs from jejunum (Figure 8, A). Similar findings occurred for REG3G protein (Figure 8, B). Moreover, mOPN increased the mRNA expression of Ahr and TJ proteins (Occludin, Claudin3, JamA) in IECs from jejunum (Figure 8, C). Analysis of total, cytosolic, and nuclear AHR protein in IECs from jejunum revealed that mOPN prevented the ethanol-mediated decrease in AHR (Figure 8, D). WT mice fed ethanol and mOPN also showed higher levels of Trp, its metabolites, and SCFAs in portal serum (Figure 8, E–H). In summary, these findings indicate that both overexpression of OPN in IECs and oral administration of mOPN during chronic ethanol feeding preserve the gut microbiome, intestinal barrier integrity, and protect from ALD through similar mechanisms.
      Figure thumbnail gr8ad
      Figure 8Oral administration of mOPN induces AMPs in IECs, which preserve the gut microbiota and the intestinal barrier function. WT mice were fed control or ethanol diet for 6 weeks in the presence or absence of mOPN. mRNA expression of Reg3β, Reg3γ, and Il33 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against without mOPN control (n = 4/group) (A). REG3G protein expression in IECs from jejunum (n = 3/group) (B). mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against without mOPN control (n = 4/group) (C). Western blot of total, cytosolic and nuclear AHR in IECs from jejunum (n = 3/group) (D). Levels of Trp, its metabolites kynureine and indole metabolites (3-indoleacrylic acid + 3-indoleacrylic acid + 3-indolepropionic acid + 3-indoxyl sulfate + indole + indole-3-lactic acid + tryptamine + tryptophol) in portal serum (n = 3/group) (E–F). Level of SCFAs (acetic acid + propionic acid + butyric acid) in portal serum (n = 4/group) (G–H). Data are expressed as mean ± standard error of the mean. P <0 .05 and ∗∗P < .01 vs control; #P < .05 vs without mOPN control; ˆP < .05 vs without mOPN ethanol. C, Control diet; E, ethanol diet.
      Figure thumbnail gr8eh
      Figure 8Oral administration of mOPN induces AMPs in IECs, which preserve the gut microbiota and the intestinal barrier function. WT mice were fed control or ethanol diet for 6 weeks in the presence or absence of mOPN. mRNA expression of Reg3β, Reg3γ, and Il33 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against without mOPN control (n = 4/group) (A). REG3G protein expression in IECs from jejunum (n = 3/group) (B). mRNA expression of Ahr, Occludin, Claudin3, JamA, and Jam4 in IECs from jejunum. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against without mOPN control (n = 4/group) (C). Western blot of total, cytosolic and nuclear AHR in IECs from jejunum (n = 3/group) (D). Levels of Trp, its metabolites kynureine and indole metabolites (3-indoleacrylic acid + 3-indoleacrylic acid + 3-indolepropionic acid + 3-indoxyl sulfate + indole + indole-3-lactic acid + tryptamine + tryptophol) in portal serum (n = 3/group) (E–F). Level of SCFAs (acetic acid + propionic acid + butyric acid) in portal serum (n = 4/group) (G–H). Data are expressed as mean ± standard error of the mean. P <0 .05 and ∗∗P < .01 vs control; #P < .05 vs without mOPN control; ˆP < .05 vs without mOPN ethanol. C, Control diet; E, ethanol diet.

      Discussion

      The main findings of this study are that overexpression of OPN in the IECs protects from ALD and that oral administration of mOPN has therapeutic potential to prevent or delay ALD. In both cases, protection from ALD occurs by preserving the gut microbiome and the intestinal epithelial barrier function.
      A key finding is that OPN prevents alcohol-induced bacterial dysbiosis in the intestine, central to the pathogenesis of ALD.
      • Szabo G.
      • Petrasek J.
      Gut-liver axis and sterile signals in the development of alcoholic liver disease.
      ,
      • Cassard A.M.
      • Ciocan D.
      Microbiota, a key player in alcoholic liver disease.
      ,
      • Llopis M.
      • Cassard A.M.
      • Wrzosek L.
      • Boschat L.
      • Bruneau A.
      • Ferrere G.
      • Puchois V.
      • Martin J.C.
      • Lepage P.
      • Le Roy T.
      • Lefevre L.
      • Langelier B.
      • Cailleux F.
      • Gonzalez-Castro A.M.
      • Rabot S.
      • Gaudin F.
      • Agostini H.
      • Prevot S.
      • Berrebi D.
      • Ciocan D.
      • Jousse C.
      • Naveau S.
      • Gerard P.
      • Perlemuter G.
      Intestinal microbiota contributes to individual susceptibility to alcoholic liver disease.
      Intestinal dysbiosis participates in the onset and progression of ALD as a result of effects in the gut-liver axis.
      • Szabo G.
      • Petrasek J.
      Gut-liver axis and sterile signals in the development of alcoholic liver disease.
      ,
      • Cassard A.M.
      • Ciocan D.
      Microbiota, a key player in alcoholic liver disease.
      The intestinal epithelium is in close contact with pathogenic and beneficial microorganisms.
      • Chelakkot C.
      • Ghim J.
      • Ryu S.H.
      Mechanisms regulating intestinal barrier integrity and its pathological implications.
      ,
      • Lin L.
      • Zhang J.
      Role of intestinal microbiota and metabolites on gut homeostasis and human diseases.
      The host evolves unique regulatory mechanisms to maintain a homeostatic balance between tolerance and immunity to the microbiota.
      • Xiao Y.
      • Huang X.
      • Zhao Y.
      • Chen F.
      • Sun M.
      • Yang W.
      • Chen L.
      • Yao S.
      • Peniche A.
      • Dann S.M.
      • Sun J.
      • Golovko G.
      • Fofanov Y.
      • Miao Y.
      • Liu Z.
      • Chen D.
      • Cong Y.
      Interleukin-33 promotes REG3gamma expression in intestinal epithelial cells and regulates gut microbiota.
      A vital regulatory mechanism is intestinal AMPs, such as Reg3β and Reg3γ, mainly produced by IECs and Paneth cells.
      • Xiao Y.
      • Huang X.
      • Zhao Y.
      • Chen F.
      • Sun M.
      • Yang W.
      • Chen L.
      • Yao S.
      • Peniche A.
      • Dann S.M.
      • Sun J.
      • Golovko G.
      • Fofanov Y.
      • Miao Y.
      • Liu Z.
      • Chen D.
      • Cong Y.
      Interleukin-33 promotes REG3gamma expression in intestinal epithelial cells and regulates gut microbiota.
      ,
      • Mukherjee S.
      • Hooper L.V.
      Antimicrobial defense of the intestine.
      Alcohol drinking downregulates intestinal AMPs, causing quantitative and qualitative changes in the IM that lead to leaky gut and promote ALD.
      • Wang L.
      • Fouts D.E.
      • Starkel P.
      • Hartmann P.
      • Chen P.
      • Llorente C.
      • DePew J.
      • Moncera K.
      • Ho S.B.
      • Brenner D.A.
      • Hooper L.V.
      • Schnabl B.
      Intestinal REG3 lectins protect against alcoholic steatohepatitis by reducing mucosa-associated microbiota and preventing bacterial translocation.
      In this study, we show that overexpressing OPN in IECs or administering oral mOPN prevent the ethanol-mediated reduction in AMPs in IECs and therefore protect from ALD. To understand how OPN induces the expression of AMPs in IECs, we evaluated the mRNA expression of G protein-coupled receptor 43 (Gpr43),
      • Zhao Y.
      • Chen F.
      • Wu W.
      • Sun M.
      • Bilotta A.J.
      • Yao S.
      • Xiao Y.
      • Huang X.
      • Eaves-Pyles T.D.
      • Golovko G.
      • Fofanov Y.
      • D'Souza W.
      • Zhao Q.
      • Liu Z.
      • Cong Y.
      GPR43 mediates microbiota metabolite SCFA regulation of antimicrobial peptide expression in intestinal epithelial cells via activation of mTOR and STAT3.
      stimulator of interferon genes (Sting),
      • Yu Y.
      • Yang W.
      • Bilotta A.J.
      • Yu Y.
      • Zhao X.
      • Zhou Z.
      • Yao S.
      • Xu J.
      • Zhou J.
      • Dann S.M.
      • Li Y.
      • Cong Y.
      STING controls intestinal homeostasis through promoting antimicrobial peptide expression in epithelial cells.
      and Il33,
      • Xiao Y.
      • Huang X.
      • Zhao Y.
      • Chen F.
      • Sun M.
      • Yang W.
      • Chen L.
      • Yao S.
      • Peniche A.
      • Dann S.M.
      • Sun J.
      • Golovko G.
      • Fofanov Y.
      • Miao Y.
      • Liu Z.
      • Chen D.
      • Cong Y.
      Interleukin-33 promotes REG3gamma expression in intestinal epithelial cells and regulates gut microbiota.
      known to promote antimicrobial peptide expression in IECs. Gpr43 and Sting did not change in IECs from jejunum of OpnKI IEC (not shown). Interestingly, ethanol-fed OpnKI IEC mice and mOPN plus ethanol-fed WT mice had increased Il33 expression in jejunal IECs. Moreover OpnKI IEC mice showed high level of pSTAT3 in jejunal IECs. Studies have demonstrated that pSTAT3, under IL33 induction or alone, induce Reg3β and Reg3γ in IECs.
      • Xiao Y.
      • Huang X.
      • Zhao Y.
      • Chen F.
      • Sun M.
      • Yang W.
      • Chen L.
      • Yao S.
      • Peniche A.
      • Dann S.M.
      • Sun J.
      • Golovko G.
      • Fofanov Y.
      • Miao Y.
      • Liu Z.
      • Chen D.
      • Cong Y.
      Interleukin-33 promotes REG3gamma expression in intestinal epithelial cells and regulates gut microbiota.
      ,
      • Zhao Y.
      • Chen F.
      • Wu W.
      • Sun M.
      • Bilotta A.J.
      • Yao S.
      • Xiao Y.
      • Huang X.
      • Eaves-Pyles T.D.
      • Golovko G.
      • Fofanov Y.
      • D'Souza W.
      • Zhao Q.
      • Liu Z.
      • Cong Y.
      GPR43 mediates microbiota metabolite SCFA regulation of antimicrobial peptide expression in intestinal epithelial cells via activation of mTOR and STAT3.
      These results suggest that OPN may induce the expression of AMPs in IECs by pSTAT3 through IL33 signaling or directly induces STAT3 phosphorylation in IECs. However, the specific effect of OPN on IL33 or STAT3 in IECs to induce the production of AMPs needs further investigation. More importantly, this study reveals that the IM in OpnKI IEC mice is resistant to alcohol-induced bacterial dysbiosis and explains why these mice are protected from ALD. This is also supported by less alcohol-induced liver injury in OpnKI IEC mice and WT mice with FMT from OpnKI IEC mice.
      A second finding is that OPN preserves the gut microbiome and the intestinal epithelial barrier function by maintaining TJs, and therefore, protects from ALD. The intestinal epithelium, a physical barrier of IECs sealed through TJs,
      • Chelakkot C.
      • Ghim J.
      • Ryu S.H.
      Mechanisms regulating intestinal barrier integrity and its pathological implications.
      ,
      • Ulluwishewa D.
      • Anderson R.C.
      • McNabb W.C.
      • Moughan P.J.
      • Wells J.M.
      • Roy N.C.
      Regulation of tight junction permeability by intestinal bacteria and dietary components.
      maintains gut barrier integrity and is the first line of defense against bacterial toxins and pathogens in the intestinal lumen.
      • Ulluwishewa D.
      • Anderson R.C.
      • McNabb W.C.
      • Moughan P.J.
      • Wells J.M.
      • Roy N.C.
      Regulation of tight junction permeability by intestinal bacteria and dietary components.
      ,
      • Lee S.H.
      Intestinal permeability regulation by tight junction: implication on inflammatory bowel diseases.
      Intestinal bacteria are involved in metabolism
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      ,
      • Gao B.
      • Duan Y.
      • Lang S.
      • Barupal D.
      • Wu T.C.
      • Valdiviez L.
      • Roberts B.
      • Choy Y.Y.
      • Shen T.
      • Byram G.
      • Zhang Y.
      • Fan S.
      • Wancewicz B.
      • Shao Y.
      • Vervier K.
      • Wang Y.
      • Zhou R.
      • Jiang L.
      • Nath S.
      • Loomba R.
      • Abraldes J.G.
      • Bataller R.
      • Tu X.M.
      • Starkel P.
      • Lawley T.D.
      • Fiehn O.
      • Schnabl B.
      Functional microbiomics reveals alterations of the gut microbiome and host co-metabolism in patients with alcoholic hepatitis.
      and signal to IECs to maintain gut barrier integrity.
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      An essential player in this scenario is the Ahr, which supports TJs in IECs
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      and protects from ALD.
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      Small-molecules such as SCFAs (acetate, propionate, butyrate) and Trp metabolites (indole metabolites and others), synthesized by intestinal bacteria, are secreted into the intestinal lumen and act as endogenous agonists of Ahr.
      • Scott S.A.
      • Fu J.
      • Chang P.V.
      Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
      ,
      • Jin U.H.
      • Cheng Y.
      • Park H.
      • Davidson L.A.
      • Callaway E.S.
      • Chapkin R.S.
      • Jayaraman A.
      • Asante A.
      • Allred C.
      • Weaver E.A.
      • Safe S.
      Short chain fatty acids enhance aryl hydrocarbon (Ah) responsiveness in mouse colonocytes and Caco-2 human colon cancer cells.
      ,
      • Rosser E.C.
      • Piper C.J.M.
      • Matei D.E.
      • Blair P.A.
      • Rendeiro A.F.
      • Orford M.
      • Alber D.G.
      • Krausgruber T.
      • Catalan D.
      • Klein N.
      • Manson J.J.
      • Drozdov I.
      • Bock C.
      • Wedderburn L.R.
      • Eaton S.
      • Mauri C.
      Microbiota-derived metabolites suppress arthritis by amplifying aryl-hydrocarbon receptor activation in regulatory B cells.
      Intestinal dysbiosis due to alcohol consumption results in impaired bacterial metabolism, including Trp metabolism
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      ,
      • Gao B.
      • Duan Y.
      • Lang S.
      • Barupal D.
      • Wu T.C.
      • Valdiviez L.
      • Roberts B.
      • Choy Y.Y.
      • Shen T.
      • Byram G.
      • Zhang Y.
      • Fan S.
      • Wancewicz B.
      • Shao Y.
      • Vervier K.
      • Wang Y.
      • Zhou R.
      • Jiang L.
      • Nath S.
      • Loomba R.
      • Abraldes J.G.
      • Bataller R.
      • Tu X.M.
      • Starkel P.
      • Lawley T.D.
      • Fiehn O.
      • Schnabl B.
      Functional microbiomics reveals alterations of the gut microbiome and host co-metabolism in patients with alcoholic hepatitis.
      and SCFAs synthesis.
      • Pohl K.
      • Moodley P.
      • Dhanda A.D.
      Alcohol’s impact on the gut and liver.
      As a result, there is reduced Ahr signaling, loss of TJs, impairment of intestinal barrier function, and worsening of ALD.
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      ,
      • Wang H.
      • Zhou H.
      • Zhang Q.
      • Poulsen K.L.
      • Taylor V.
      • McMullen M.R.
      • Czarnecki D.
      • Dasarathy D.
      • Yu M.
      • Liao Y.
      • Allende D.S.
      • Chen X.
      • Hong L.
      • Zhao J.
      • Yang J.
      • Nagy L.E.
      • Li X.
      Inhibition of IRAK4 kinase activity improves ethanol-induced liver injury in mice.
      The present study highlights that overexpression of OPN in IECs or oral administration of mOPN prevents the alcohol-mediated downregulation of Ahr signaling in IECs. Previous studies demonstrated that alcohol consumption lowers the abundance of bacteria associated with Trp metabolism and synthesis of SCFAs.
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      ,
      • Pohl K.
      • Moodley P.
      • Dhanda A.D.
      Alcohol’s impact on the gut and liver.
      We show that OPN stimulates the growth of Trp-metabolizing and SCFAs-synthesizing bacteria in the intestine under alcohol feeding. These include Bifidobacterium,
      • Parada Venegas D.
      • De la Fuente M.K.
      • Landskron G.
      • Gonzalez M.J.
      • Quera R.
      • Dijkstra G.
      • Harmsen H.J.M.
      • Faber K.N.
      • Hermoso M.A.
      Short chain fatty acids (SCFAs)-mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases.
      ,
      • Gao K.
      • Mu C.L.
      • Farzi A.
      • Zhu W.Y.
      Tryptophan metabolism: a link between the gut microbiota and brain.
      ,
      • Roager H.M.
      • Licht T.R.
      Microbial tryptophan catabolites in health and disease.
      Eubacterium,
      • Parada Venegas D.
      • De la Fuente M.K.
      • Landskron G.
      • Gonzalez M.J.
      • Quera R.
      • Dijkstra G.
      • Harmsen H.J.M.
      • Faber K.N.
      • Hermoso M.A.
      Short chain fatty acids (SCFAs)-mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases.
      ,
      • Roager H.M.
      • Licht T.R.
      Microbial tryptophan catabolites in health and disease.
      Prevotella,
      • Choi S.C.
      • Brown J.
      • Gong M.
      • Ge Y.
      • Zadeh M.
      • Li W.
      • Croker B.P.
      • Michailidis G.
      • Garrett T.J.
      • Mohamadzadeh M.
      • Morel L.
      Gut microbiota dysbiosis and altered tryptophan catabolism contribute to autoimmunity in lupus-susceptible mice.
      ,
      • Trautmann A.
      • Schleicher L.
      • Deusch S.
      • Gatgens J.
      • Steuber J.
      • Seifert J.
      Short-chain fatty acids modulate metabolic pathways and membrane lipids in Prevotella bryantii B14.
      Allloprevotella,
      • Ma Q.
      • Li Y.
      • Wang J.
      • Li P.
      • Duan Y.
      • Dai H.
      • An Y.
      • Cheng L.
      • Wang T.
      • Wang C.
      • Wang T.
      • Zhao B.
      Investigation of gut microbiome changes in type 1 diabetic mellitus rats based on high-throughput sequencing.
      Desulfovibrio,
      • Gao K.
      • Mu C.L.
      • Farzi A.
      • Zhu W.Y.
      Tryptophan metabolism: a link between the gut microbiota and brain.
      ,
      • Sawin E.A.
      • De Wolfe T.J.
      • Aktas B.
      • Stroup B.M.
      • Murali S.G.
      • Steele J.L.
      • Ney D.M.
      Glycomacropeptide is a prebiotic that reduces Desulfovibrio bacteria, increases cecal short-chain fatty acids, and is anti-inflammatory in mice.
      Butyricicoccus,
      • Chang S.C.
      • Shen M.H.
      • Liu C.Y.
      • Pu C.M.
      • Hu J.M.
      • Huang C.J.
      A gut butyrate-producing bacterium Butyricicoccus pullicaecorum regulates short-chain fatty acid transporter and receptor to reduce the progression of 1,2-dimethylhydrazine-associated colorectal cancer.
      Butyricimonas,
      • Nagpal R.
      • Wang S.
      • Ahmadi S.
      • Hayes J.
      • Gagliano J.
      • Subashchandrabose S.
      • Kitzman D.W.
      • Becton T.
      • Read R.
      • Yadav H.
      Human-origin probiotic cocktail increases short-chain fatty acid production via modulation of mice and human gut microbiome.
      and Roseburia.
      • Parada Venegas D.
      • De la Fuente M.K.
      • Landskron G.
      • Gonzalez M.J.
      • Quera R.
      • Dijkstra G.
      • Harmsen H.J.M.
      • Faber K.N.
      • Hermoso M.A.
      Short chain fatty acids (SCFAs)-mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases.
      ,
      • Agus A.
      • Clement K.
      • Sokol H.
      Gut microbiota-derived metabolites as central regulators in metabolic disorders.
      ,
      • Seo B.
      • Jeon K.
      • Moon S.
      • Lee K.
      • Kim W.K.
      • Jeong H.
      • Cha K.H.
      • Lim M.Y.
      • Kang W.
      • Kweon M.N.
      • Sung J.
      • Kim W.
      • Park J.H.
      • Ko G.
      Roseburia spp. Abundance associates with alcohol consumption in humans and its administration ameliorates alcoholic fatty liver in mice.
      An increase in these bacteria enhances the synthesis of SCFAs from undigested carbohydrates and indole derivatives from Trp catabolism in the gut. This is revealed by high levels of SCFAs (acetate, propionate, butyrate) and of indole compounds (3-indoleacrylic acid, 3-indoleacrylic acid, 3-indolepropionic acid, 3-indoxyl sulfate, indole) in portal serum from OpnKI IEC mice and from WT mice with oral administration of mOPN. These SCFAs and indole derivatives are well-known ligands for Ahr, which activate it in IECs. SCFA and indole signaling through Ahr in IECs increases the expression of TJ proteins, as shown by increased mRNA expression of Occludin, JamA, and Jam4 in IECs from jejunum of OpnKI IEC and Claudin-3 and JamA in IECs from jejunum of WT mice with oral administration of mOPN. This preserves the gut barrier function and limits the translocation of bacteria and bacterial products from the gut to the portal blood.
      In ALD, disruption of the intestinal epithelial barrier enhances intestinal permeability
      • Ge X.
      • Lu Y.
      • Leung T.M.
      • Sorensen E.S.
      • Nieto N.
      Milk osteopontin, a nutritional approach to prevent alcohol-induced liver injury.
      and allows translocation of bacteria and bacterial products from the gut lumen to the portal circulation.
      • Ge X.
      • Leung T.M.
      • Arriazu E.
      • Lu Y.
      • Urtasun R.
      • Christensen B.
      • Fiel M.I.
      • Mochida S.
      • Sorensen E.S.
      • Nieto N.
      Osteopontin binding to lipopolysaccharide lowers tumor necrosis factor-alpha and prevents early alcohol-induced liver injury in mice.
      Upon reaching the liver, they stimulate KCs, infiltrating MFs and neutrophils to produce proinflammatory cytokines, which damage hepatocytes.
      • Szabo G.
      • Petrasek J.
      Gut-liver axis and sterile signals in the development of alcoholic liver disease.
      We demonstrate that OPN preserves the gut barrier function and blocks the translocation of bacterial products from the gut to the liver as seen by reduced portal serum LPS and RNA expression of Tnfα, interleukin-1β (Il1β), Ccl2, and Ccl3 in the liver from ethanol-fed OpnKI IEC mice and ethanol-fed WT mice with oral administration of mOPN.
      Additionally, we demonstrate comparable alcohol-induced liver injury between male and female mice; this could be because of the genetic background of the mice and/or the ethanol feeding model. However, ethanol-fed WT and OpnKI IEC females show higher liver TGs than ethanol-fed males. Ethanol-fed WT females show higher Il1β expression in liver, whereas ethanol-fed WT and OpnΔIEC males show increased gut permeability and higher Tnfα, Ccl2, and Ccl3 expression in liver than ethanol-fed females. Further, based on liver TG and serum ALT activity, the protective effects of OPN overexpression are greater in males than in females.
      Our study has some limitations. First, the 2 mouse models, OpnKI IEC and OpnΔIEC, show heterogeneity in the extent of alcohol-induced liver injury. Overexpression of OPN in IECs prevents the alcohol-induced increase in gut permeability, and deletion of OPN from IEC increases gut permeability after alcohol exposure but does not show further worsening of gut permeability. Second, deletion of OPN from IECs does not downregulate the expression of AMPs, Ahr, and TJs in IECs from jejunum. Third, FMT from ethanol-fed WT mice to OPN KI IEC and WT mice lack the OPN KI IEC and WT mice without FMT as control. Last, in the FMT experiment, only male mice were used; therefore, these results may be gender-specific.
      In conclusion, we show that natural induction plus overexpression of OPN in IECs or oral administration of mOPN during ethanol feeding protect from ALD by preserving the gut-liver axis. OPN increases AMPs such as Reg3β and Reg3γ in IECs, which regulate the IM and prevent alcohol-mediated loss of Trp-metabolizing and SCFAs-synthesizing bacteria in the gut. This increases Ahr signaling in IECs, prevents disruption of the intestinal epithelial barrier, and protects from ALD. Therefore, induction of OPN in the intestine or oral administration of mOPN could benefit patients with ALD. The latter therapeutic approach is feasible, as administration of OPN has proven safe, for example, incorporated in infant formulas as Lacprodan OPN-10 (Arla Foods) or as bovine mOPN in clinical trials to study its effect on growth, health, and immune function in infants (NCT04306263, NCT03331276, NCT00970398).

      Materials and Methods

      General Methodology

      Details on general methodology, such as immunohistochemistry for OPN, H&E staining, measurement of serum ALT activity, liver TGs, serum alcohol, total RNA extraction, quantitative real-time polymerase chain reaction analysis, and measurement of FITC-dextran and LPS in portal serum are described in previous publications.
      • Ge X.
      • Leung T.M.
      • Arriazu E.
      • Lu Y.
      • Urtasun R.
      • Christensen B.
      • Fiel M.I.
      • Mochida S.
      • Sorensen E.S.
      • Nieto N.
      Osteopontin binding to lipopolysaccharide lowers tumor necrosis factor-alpha and prevents early alcohol-induced liver injury in mice.
      ,
      • Ge X.
      • Antoine D.J.
      • Lu Y.
      • Arriazu E.
      • Leung T.M.
      • Klepper A.L.
      • Branch A.D.
      • Fiel M.I.
      • Nieto N.
      High mobility group box-1 (HMGB1) participates in the pathogenesis of alcoholic liver disease (ALD).
      • Ge X.
      • Arriazu E.
      • Magdaleno F.
      • Antoine D.J.
      • Dela Cruz R.
      • Theise N.
      • Nieto N.
      High mobility group box-1 drives fibrosis progression signaling via the receptor for advanced glycation end products in mice.
      • Arriazu E.
      • Ge X.
      • Leung T.M.
      • Magdaleno F.
      • Lopategi A.
      • Lu Y.
      • Kitamura N.
      • Urtasun R.
      • Theise N.
      • Antoine D.J.
      • Nieto N.
      Signalling via the osteopontin and high mobility group box-1 axis drives the fibrogenic response to liver injury.
      • Cubero F.J.
      • Nieto N.
      Arachidonic acid stimulates TNFalpha production in Kupffer cells via a reactive oxygen species-pERK1/2-Egr1-dependent mechanism.
      • Nieto N.
      Oxidative-stress and IL-6 mediate the fibrogenic effects of [corrected] Kupffer cells on stellate cells.
      The sequence of the primers used is listed in Table 1. Cytosolic and nuclear proteins were isolated with the compartmental protein extraction kit (Millipore, Burlington, MA). Western blot analysis of STAT3, pSTAT3, Histone H3, AHR, REG3G, and GAPDH was performed using antibodies 9132S, 9145S, and 9715S (Cell Signaling Technology, Inc, Danvers, MA), MA1-514 and PA5-50450 (Invitrogen, Carlsbad, CA), and sc-32233 (Santa Cruz, Dallas, TX), respectively.
      Table 1Sequence of Primer Pairs Used in qRT-PCR Analysis
      GenesForward primers (5'-3')Reverse primers (5'-3')
      16SAGAGTTTGATCCTGGCTCAGTGCTGCCTCCCGTAGGAGT
      18SCGCGGTTCTATTTTGTTGGTAGTCGGCATCGTTTATGGTC
      AhrTGACAGAAATGGAGGCCAGGACTGCTGTGACAACCAGCACAAA
      β-actinAGCCATGTACGTAGCCATCCCTCTCAGCTGTGGTGGTGAA
      Ccl2GGCATCCCTCTACCCAAGACGGGCGTTAACTGCATCTGGA
      Ccl3TTCTCTGTACCATGACACTCTGCCGTGGAATCTTCCGGCTGTAG
      Claudin3TTCCCAAGAACTGGGCTGGGGCCCGTTTCATGGTTTGCCT
      GapdhAGCGAGGAACAGCGACAGAAACTCCCATGGTTGGGCTCTG
      Il1βTGCCACCTTTTGACAGTGATGTGATGTGCTGCTGCGAGATT
      Il33GGCTCACTGCAGGAAAGTACAGTTGCCGGGGAAATCTTGGAG
      Jam4AAACGCAGCAGTAGCCTTCCTGAACCTTGGACCTCTCAGCA
      JamATAATGGGCACCGAGGGGAAAGAGCAGTGTACACCGAACCCT
      OccludinTTGAAAGTCCACCTCCTTACAGACCGGATAAAAAGAGTACGCTGG
      OpnGCAGTCTTCTGCGGCAGGCAGGGTCAGGCACCAGCCATGTG
      Reg3βAACAGCCTGCTCCGTCATGTAACTAATGCGTGCGGAGGGT
      Reg3γCGCTGAAGCTTCCTTCCTGTCCCATCCACCTCTGTTGGGTT
      TnfαCTGAACTTCGGGGTGATCGGGGCTTGTCACTCGAATTTTGAGA
      qRT-PCR, Quantitative real-time polymerase chain reaction.

      Mice

      Opnfl/fl mice were generated in our laboratory. The OpnloxP allele was created inserting loxP sites to remove exons 4–7. Opn-Stopfl/fl mice were donated by Dr Panoutsakopoulou (Biomedical Research Foundation, Academy of Athens, Greece).
      • Kourepini E.
      • Aggelakopoulou M.
      • Alissafi T.
      • Paschalidis N.
      • Simoes D.C.
      • Panoutsakopoulou V.
      Osteopontin expression by CD103- dendritic cells drives intestinal inflammation.
      Both Opn-Stopfl/fl and Opnfl/fl mice were bred with Vili-Cre (JAX004586, the Jackson Laboratory, Bar Harbor, ME) to generate IEC-specific knock-in (OpnKI IEC) and knock-out (OpnΔIEC) mice, respectively. Villi-Cre mice were used as controls and referred to as WT on the text or figures for simplicity purposes only. The targeting strategy was validated by immunohistochemistry in the jejunum (Figure 9, A–B). We also confirmed that overexpression or deletion OPN in IECs does not affect OPN expression in the liver (Figure 9, C–D). All mice were in C57BL/6J background and lacked a liver or intestine phenotype in the absence of treatment.
      Figure thumbnail gr9ad
      Figure 9Validation of the targeting strategy and experimental design of the FMT. OPN immunohistochemistry in the jejunum from male and female mice fed with control diet (orange arrows indicate OPN staining in IECs) (A–B). Opn mRNA expression in liver from male and female OpnKI IEC and OpnΔIEC mice fed with control diet. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against WT (n = 6/group) (C–D). Experimental design of the FMT (E).
      Figure thumbnail gr9e
      Figure 9Validation of the targeting strategy and experimental design of the FMT. OPN immunohistochemistry in the jejunum from male and female mice fed with control diet (orange arrows indicate OPN staining in IECs) (A–B). Opn mRNA expression in liver from male and female OpnKI IEC and OpnΔIEC mice fed with control diet. Data were normalized with Gapdh as housekeeping gene, and fold change (FC) was calculated against WT (n = 6/group) (C–D). Experimental design of the FMT (E).

      Model of Alcohol-induced Liver Injury

      The LDC model was used to provoke early alcohol-induced liver injury.
      • Lieber C.S.
      • DeCarli L.M.
      The feeding of alcohol in liquid diets: two decades of applications and 1982 update.
      The control and ethanol LDC diets (Bio-Serv Inc, Frenchtown, NJ) are equicaloric and have the same composition of fat (42% of calories) and protein (16% of calories). The content of carbohydrates is 42% of total calories (dextrin-maltose) in the control diet and 12% of total calories in the ethanol diet, where up to 30% of carbohydrate-derived calories are replaced by ethanol.
      • Lieber C.S.
      • DeCarli L.M.
      The feeding of alcohol in liquid diets: two decades of applications and 1982 update.
      Equal number of male and female mice (12 weeks old) were acclimatized to the liquid diet by feeding control diet for 7 days. Then, the percentage of ethanol-derived calories was progressively increased from 10% (1 week) to 20% (1 week), 25% (2 weeks), and 30% (2 weeks) in the ethanol group. The control groups remained on control diet. Mice were gavaged with 4 μL/g of body weight of FITC-dextran 4 hours before sacrifice. Liver and body weight were recorded upon sacrifice to calculate the liver-to-body weight ratio. Systemic and portal blood were drawn under anesthesia from the submandibular and portal veins, respectively, to obtain serum. Serum, liver, intestine and stool samples were collected and stored at −80 °C for further analysis.

      Pathology

      Sections from left liver lobe, duodenum, jejunum, ileum, and colon were obtained, fixed in 10% neutral formalin buffer, processed, and sectioned (4 μm) for H&E staining. Liver injury was determined by a liver pathologist according to the Brunt classification.
      • Hubscher S.G.
      Histological assessment of non-alcoholic fatty liver disease.
      The steatosis grade was 0 = <5%; 1 = 5% to 33%; 2 = >33% to 66%; and 3 = >66%. Steatosis was noted to be macrovascular, microvascular, or both. Inflammation was noted based on the presence of inflammatory foci and was scored as follows: 0 for none; 1 for <2 foci/field; 2 for 2 to 4 foci/field; and 3 for >4 foci/field. Ten fields per section were observed to for semiquantitative scoring of liver steatosis and inflammation.

      FMT

      Three independent FMT experiments were performed in 12-week-old male mice. First, FMT from OpnKI IEC to WT (C57BL/6J, Stock No. 000664) mice. Second, FMT from WT fed ethanol for 6 weeks to OpnKI IEC mice. Third, FMT from WT fed ethanol for 6 weeks to WT mice. Briefly, feces (100 mg) were dissociated in 1 mL of sterile saline solution by vigorous shaking followed by centrifugation at 800 × g for 3 minutes.
      • Liu Y.
      • Fan L.
      • Cheng Z.
      • Yu L.
      • Cong S.
      • Hu Y.
      • Zhu L.
      • Zhang B.
      • Cheng Y.
      • Zhao P.
      • Zhao X.
      • Cheng M.
      Fecal transplantation alleviates acute liver injury in mice through regulating Treg/Th17 cytokines balance.
      The supernatant containing the FM suspension was stored in aliquots (200 μL) at −80 °C until FMTs were performed. Mice were fasted for 1 hour, and the bowel was cleansed with polyethylene glycol (Macrogol 4000, Thermo Fisher Scientific, Carlsbad, CA). Polyethylene glycol (200 μL of a solution of 425 g/L in water) was administered by oral gavage.
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      After 4 hours, mice received 200 μL of the FM suspension by oral gavage. Mice had free access to control or ethanol diet for 6 weeks. In the third FMT experiment, mice received control or ethanol diet supplemented with purified bovine mOPN (gift from Arla Foods, Viby, Denmark) at a concentration of 200 μg/mL.
      • Ge X.
      • Lu Y.
      • Leung T.M.
      • Sorensen E.S.
      • Nieto N.
      Milk osteopontin, a nutritional approach to prevent alcohol-induced liver injury.
      FMT was performed twice a week for 6 weeks, and bowel cleansing was done once before the first FMT
      • Wrzosek L.
      • Ciocan D.
      • Hugot C.
      • Spatz M.
      • Dupeux M.
      • Houron C.
      • Lievin-Le Moal V.
      • Puchois V.
      • Ferrere G.
      • Trainel N.
      • Mercier-Nome F.
      • Durand S.
      • Kroemer G.
      • Voican C.S.
      • Emond P.
      • Straube M.
      • Sokol H.
      • Perlemuter G.
      • Cassard A.M.
      Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
      (Figure 9, E).

      Metagenomics

      DNA was isolated from fecal samples using the DNeasy power soil kit (Qiagen, Germantown, MD).
      • Das S.
      • Ge X.
      • Han H.
      • Desert R.
      • Song Z.
      • Athavale D.
      • Chen W.
      • Gaskell H.
      • Lantvit D.
      • Guzman G.
      • Nieto N.
      The integrated “multiomics” landscape at peak injury and resolution from alcohol-associated liver disease.
      Sequencing of 16S rRNA was performed at the Argonne National Laboratory (Lemont, IL) using an Illumina micro MiSeq platform.
      • Caporaso J.G.
      • Lauber C.L.
      • Walters W.A.
      • Berg-Lyons D.
      • Huntley J.
      • Fierer N.
      • Owens S.M.
      • Betley J.
      • Fraser L.
      • Bauer M.
      • Gormley N.
      • Gilbert J.A.
      • Smith G.
      • Knight R.
      Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.
      ,
      • Caporaso J.G.
      • Lauber C.L.
      • Walters W.A.
      • Berg-Lyons D.
      • Lozupone C.A.
      • Turnbaugh P.J.
      • Fierer N.
      • Knight R.
      Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.
      The V4 region of the 16S rRNA gene was amplified using specific barcodes and primer sequences listed in Table 2. Data were analyzed using the Illumina 16S metagenomics App in BaseSpace. Demultiplexed fastq sequences were processed for quantitative and qualitative insight into the microbial ecology. Alpha and beta diversity were determined based on the Shannon’s index and weighted UniFrac distances, respectively. For comparisons, nonparametric 1-way analysis of variance followed by the Fisher LSD post-hoc tests or a combination of fold change analysis and t tests (volcano plot), were used, and a cutoff of ≤ .05 adjusted P-value (false discovery rate) or P-value was considered for the statistical significance.
      Table 2Sequence of Barcodes and Primers Used in 16s rRNA Sequencing
      SI.NoBarcode sequenceLinker primer sequence
      S1GTCCGCAAGTTAGTGTGYCAGCMGCCGCGGTAA
      S2CAACACATGCTGGTGTGYCAGCMGCCGCGGTAA
      S3CATACCGTGAGTGTGTGYCAGCMGCCGCGGTAA
      S4GTCCATGGTTCGGTGTGYCAGCMGCCGCGGTAA
      S5ACCATTACCATTGTGTGYCAGCMGCCGCGGTAA
      S6TGGTAAGAGTCTGTGTGYCAGCMGCCGCGGTAA
      S7CCAGCCTTCAGAGTGTGYCAGCMGCCGCGGTAA
      S8ATTCAGATGGCAGTGTGYCAGCMGCCGCGGTAA
      S9TTATTCTCTAGGGTGTGYCAGCMGCCGCGGTAA
      S10TTCGTGAGGATAGTGTGYCAGCMGCCGCGGTAA
      S11GCGTCATGCATCGTGTGYCAGCMGCCGCGGTAA
      S12CCTCGGGTACTAGTGTGYCAGCMGCCGCGGTAA
      S13CTACTAGCGGTAGTGTGYCAGCMGCCGCGGTAA
      S14CGATTTAGGCCAGTGTGYCAGCMGCCGCGGTAA
      S15GCTTGGTAGGTTGTGTGYCAGCMGCCGCGGTAA
      S16AGGCGCTCTCCTGTGTGYCAGCMGCCGCGGTAA
      S17ACCTGATCCGCAGTGTGYCAGCMGCCGCGGTAA
      S18GAGATTTAAGCAGTGTGYCAGCMGCCGCGGTAA
      S19TGGGTCCCACATGTGTGYCAGCMGCCGCGGTAA
      S20ATTCTGCCGAAGGTGTGYCAGCMGCCGCGGTAA
      S21TTGCCTGGGTCAGTGTGYCAGCMGCCGCGGTAA
      S22TCGTAAGCCGTCGTGTGYCAGCMGCCGCGGTAA
      S23ATTAGATTGGAGGTGTGYCAGCMGCCGCGGTAA
      S24TTAGCCCAGCGTGTGTGYCAGCMGCCGCGGTAA
      S25ACTAGGATCAGTGTGTGYCAGCMGCCGCGGTAA
      S26TACACCTTACCTGTGTGYCAGCMGCCGCGGTAA
      S27AGTGTCGATTCGGTGTGYCAGCMGCCGCGGTAA
      S28ATCTCGCTGGGTGTGTGYCAGCMGCCGCGGTAA
      S29ATTCCATTTAGAGTGTGYCAGCMGCCGCGGTAA
      S30CTGCTGGGAAGGGTGTGYCAGCMGCCGCGGTAA
      S31CAGGGAGGATCCGTGTGYCAGCMGCCGCGGTAA
      S32GGACTATCGTTGGTGTGYCAGCMGCCGCGGTAA
      S33CAATTCTGCTTCGTGTGYCAGCMGCCGCGGTAA
      S34GTTATACATTCAGTGTGYCAGCMGCCGCGGTAA
      S35GATGTCATAGCCGTGTGYCAGCMGCCGCGGTAA
      S36CGTGACAATAGTGTGTGYCAGCMGCCGCGGTAA
      S37GAGGGCGTGATCGTGTGYCAGCMGCCGCGGTAA
      S38ATGGTCACAAACGTGTGYCAGCMGCCGCGGTAA
      S39TTGTATGACAGGGTGTGYCAGCMGCCGCGGTAA
      S40TGGAAACCATTGGTGTGYCAGCMGCCGCGGTAA
      S41AACCCTAACTGGGTGTGYCAGCMGCCGCGGTAA
      S42TATAACAATCTCGTGTGYCAGCMGCCGCGGTAA
      S43ACGAGGAGTCGAGTGTGYCAGCMGCCGCGGTAA
      S44TGGCGATACGTTGTGTGYCAGCMGCCGCGGTAA
      S45CTTTCAGGACCGGTGTGYCAGCMGCCGCGGTAA
      S46CGATCACCACAAGTGTGYCAGCMGCCGCGGTAA
      S47AGTAGGAGGCACGTGTGYCAGCMGCCGCGGTAA
      S48TGTACGGATAACGTGTGYCAGCMGCCGCGGTAA
      S49GGTTCCATTAGGGTGTGYCAGCMGCCGCGGTAA
      S50AAGGAAGTATATGTGTGYCAGCMGCCGCGGTAA
      S51TTGTTACGTTCCGTGTGYCAGCMGCCGCGGTAA
      S52CGCTACAACTCGGTGTGYCAGCMGCCGCGGTAA
      S53ATCAGCCAGCTCGTGTGYCAGCMGCCGCGGTAA
      S54ATTTCTTAGCCAGTGTGYCAGCMGCCGCGGTAA
      S55ATTCGCCAAGAAGTGTGYCAGCMGCCGCGGTAA
      S56AGTGCGTTCTAGGTGTGYCAGCMGCCGCGGTAA
      S57CAATTAATGTATGTGTGYCAGCMGCCGCGGTAA
      S58CTGTGATCGGATGTGTGYCAGCMGCCGCGGTAA
      S59GATCGGTTAATGGTGTGYCAGCMGCCGCGGTAA
      S60TGGACGGCCCAGGTGTGYCAGCMGCCGCGGTAA

      Measurement of Trp Metabolites and SCFAs

      Trp and its metabolites (kynureine and indoles) and SCFAs were measured in portal serum by targeted metabolite profiling at the Metabolomics Core from the Roy J. Carver Biotechnology Center at the University of Illinois at Urbana-Champaign.
      Trp and its metabolites were quantified using liquid chromatography–mass spectrometry (LC/MS). Briefly, 30 μL of serum were deproteinized with 70 μL of methanol and centrifuged to obtain the supernatant. The supernatants and the standards for Trp and its metabolites were spiked with 5 μL of the internal standard (DL-Chlorophenyl alanine, 0.01 mg/ml) and quantified by LC/MS in a Vanquish high-performance liquid chromatography (Thermo Fisher Scientific, Waltham, MA) with a Polaris 3 C18-Ether 2x100 mm (3 μ) column at a flow rate of 500 μL/min. As mobile phases, 0.1% formic acid in water (A) and methanol (B) were used with the following gradient: 0 to 0.5 minutes–0% B, 3 minutes–100% B, 3 to 4.5 minutes–100% B, and 4.5 to 6 min–0% B. Mass spectrometry was performed in a TSQ Altis LC-MS/MS (Thermo Fisher Scientific). Data were acquired in both negative and positive SRM modes. Integration and quantitation of the peaks were performed using Thermo TraceFinder. For Trp, 3-Indoleacrylic acid and 3-Indoxyl, a standard curve 200 to 0.5 μg/mL was used, and for the rest of the metabolites, a standard curve of 500 to 0.1 ng/mL was used.
      After the LC/MS measurements, the same samples were used to quantify SCFAs by gas chromatography/MS on an Agilent 7890 gas chromatograph, with a 5977A mass selective detector and a 7693 autosampler (Agilent Inc, Palo Alto, CA). Using a split mode (15:1), 1 μL of sample was injected and analyzed on a 30-m HP-INNOWAX column with 0.25 mm inner diameter and 0.25 μm film thickness (Agilent). An injection temperature of 200 °C, mass selective detector transfer line of 200 °C, adjusted ion source of 230 °C, and a constant flow rate of 1 mL/min of helium carrier gas were used for the analysis. The temperature program was 2 minutes at 70 °C, followed by an oven temperature ramp of 10 °C/minute to 190 °C and 40 °C to 240 °C for a final 2 minutes. The MS was performed in positive electron impact mode at 69.9 eV ionization energy in m/z 30 to 300 scan range in combined scan and selected ion monitoring modes targeted for m/z 43, 45, 46, 60, and 74. Using Mass Hunter Quantitative Analysis B.08.00 (Agilent) software, targeted peaks were evaluated. To generate standard curves, 100 to 0.01 mg/L concentrations were used.

      Isolation of IECs

      IECs were isolated from the jejunum. In this protocol, first the adhesions between the IECs were disrupted by chelating Ca+2 ions, and then mechanical separation of IECs was performed using a vortex.
      • Zeineldin M.
      • Neufeld K.
      Isolation of epithelial cells from mouse gastrointestinal tract for WesTERN Blot or RNA analysis.

      Study Approval

      All mice received humane care according to the criteria outlined in the guide for the care and use of laboratory animals prepared by the National Academy of Sciences and published by the National Institutes of Health. Housing and husbandry conditions were approved by the Institutional Animal Care and Use Committee office at the University of Illinois at Chicago prior to initiation of the studies. All in vivo experiments were carried out according to the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines.

      Statistical Analysis

      Statistical analyses were performed using GraphPad Prism v7 with statistical significance set at P < .05. Comparisons between 2 groups were performed using the nonparametric t tests (Mann-Whitney U test). For comparisons between 3 groups, nonparametric 1-way analysis of variance (Kruskal-Wallis test) followed by post hoc comparisons by the Bonferroni method were used.

      CRediT Authorship Contributions

      Sukanta Das, PhD (Conceptualization: Lead; Data curation: Lead; Formal analysis: Lead; Methodology: Lead; Writing – original draft: Lead)
      Zhuolun Song, PhD (Conceptualization: Supporting; Writing – review & editing: Supporting)
      Hui Han, PhD (Conceptualization: Supporting; Writing – review & editing: Supporting)
      Xiaodong Ge, PhD (Conceptualization: Supporting; Writing – review & editing: Supporting)
      Romain Desert, PhD (Conceptualization: Supporting; Writing – review & editing: Supporting)
      Dipti Athavale, PhD (Conceptualization: Supporting; Writing – review & editing: Supporting)
      Sai Santosh Babu Komakula, PhD (Conceptualization: Supporting; Writing – review & editing: Supporting)
      Fernando Magdaleno, PhD (Conceptualization: Supporting; Methodology: Supporting; Writing – review & editing: Supporting)
      Wei Chen, PhD (Writing – review & editing: Supporting)
      Daniel Lantvit (Methodology: Supporting)
      Grace Guzman, MD (Methodology: Supporting)
      Natalia Nieto, PhD (Conceptualization: Lead; Funding acquisition: Lead; Supervision: Lead; Writing – review & editing: Lead)

      References

        • Ge X.
        • Lu Y.
        • Leung T.M.
        • Sorensen E.S.
        • Nieto N.
        Milk osteopontin, a nutritional approach to prevent alcohol-induced liver injury.
        Am J Physiol Gastrointest Liver Physiol. 2013; 304: G929-G939
        • Ge X.
        • Leung T.M.
        • Arriazu E.
        • Lu Y.
        • Urtasun R.
        • Christensen B.
        • Fiel M.I.
        • Mochida S.
        • Sorensen E.S.
        • Nieto N.
        Osteopontin binding to lipopolysaccharide lowers tumor necrosis factor-alpha and prevents early alcohol-induced liver injury in mice.
        Hepatology. 2014; 59: 1600-1616
        • Szabo G.
        • Petrasek J.
        Gut-liver axis and sterile signals in the development of alcoholic liver disease.
        Alcohol Alcohol. 2017; 52: 414-424
        • Elamin E.
        • Jonkers D.
        • Juuti-Uusitalo K.
        • van Ijzendoorn S.
        • Troost F.
        • Duimel H.
        • Broers J.
        • Verheyen F.
        • Dekker J.
        • Masclee A.
        Effects of ethanol and acetaldehyde on tight junction integrity: in vitro study in a three dimensional intestinal epithelial cell culture model.
        PLoS One. 2012; 7e35008
        • Wang L.
        • Fouts D.E.
        • Starkel P.
        • Hartmann P.
        • Chen P.
        • Llorente C.
        • DePew J.
        • Moncera K.
        • Ho S.B.
        • Brenner D.A.
        • Hooper L.V.
        • Schnabl B.
        Intestinal REG3 lectins protect against alcoholic steatohepatitis by reducing mucosa-associated microbiota and preventing bacterial translocation.
        Cell Host Microbe. 2016; 19: 227-239
        • Hendrikx T.
        • Duan Y.
        • Wang Y.
        • Oh J.H.
        • Alexander L.M.
        • Huang W.
        • Starkel P.
        • Ho S.B.
        • Gao B.
        • Fiehn O.
        • Emond P.
        • Sokol H.
        • van Pijkeren J.P.
        • Schnabl B.
        Bacteria engineered to produce IL-22 in intestine induce expression of REG3G to reduce ethanol-induced liver disease in mice.
        Gut. 2019; 68: 1504-1515
        • Wrzosek L.
        • Ciocan D.
        • Hugot C.
        • Spatz M.
        • Dupeux M.
        • Houron C.
        • Lievin-Le Moal V.
        • Puchois V.
        • Ferrere G.
        • Trainel N.
        • Mercier-Nome F.
        • Durand S.
        • Kroemer G.
        • Voican C.S.
        • Emond P.
        • Straube M.
        • Sokol H.
        • Perlemuter G.
        • Cassard A.M.
        Microbiota tryptophan metabolism induces aryl hydrocarbon receptor activation and improves alcohol-induced liver injury.
        Gut. 2021; 70: 1299-1308
        • Scott S.A.
        • Fu J.
        • Chang P.V.
        Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor.
        Proc Natl Acad Sci U S A. 2020; 117: 19376-19387
        • Zhong W.
        • Zhou Z.
        Alterations of the gut microbiome and metabolome in alcoholic liver disease.
        World J Gastrointest Pathophysiol. 2014; 5: 514-522
        • Gao B.
        • Ahmad M.F.
        • Nagy L.E.
        • Tsukamoto H.
        Inflammatory pathways in alcoholic steatohepatitis.
        J Hepatol. 2019; 70: 249-259
        • Wang K.X.
        • Denhardt D.T.
        Osteopontin: role in immune regulation and stress responses.
        Cytokine Growth Factor Rev. 2008; 19: 333-345
        • Song Z.
        • Chen W.
        • Athavale D.
        • Ge X.
        • Desert R.
        • Das S.
        • Han H.
        • Nieto N.
        Osteopontin takes center stage in chronic liver disease.
        Hepatology. 2021; 73: 1594-1608
        • Morales-Ibanez O.
        • Dominguez M.
        • Ki S.H.
        • Marcos M.
        • Chaves J.F.
        • Nguyen-Khac E.
        • Houchi H.
        • Affo S.
        • Sancho-Bru P.
        • Altamirano J.
        • Michelena J.
        • Garcia-Pagan J.C.
        • Abraldes J.G.
        • Arroyo V.
        • Caballeria J.
        • Laso F.J.
        • Gao B.
        • Bataller R.
        Human and experimental evidence supporting a role for osteopontin in alcoholic hepatitis.
        Hepatology. 2013; 58: 1742-1756
        • Patouraux S.
        • Bonnafous S.
        • Voican C.S.
        • Anty R.
        • Saint-Paul M.C.
        • Rosenthal-Allieri M.A.
        • Agostini H.
        • Njike M.
        • Barri-Ova N.
        • Naveau S.
        • Le Marchand-Brustel Y.
        • Veillon P.
        • Cales P.
        • Perlemuter G.
        • Tran A.
        • Gual P.
        The osteopontin level in liver, adipose tissue and serum is correlated with fibrosis in patients with alcoholic liver disease.
        PLoS One. 2012; 7e35612
        • Nakase H.
        OPeNing the epithelial barrier: osteopontin preserves gut barrier function during intestinal inflammation.
        Dig Dis Sci. 2019; 64: 294-296
        • Ito K.
        • Nakajima A.
        • Fukushima Y.
        • Suzuki K.
        • Sakamoto K.
        • Hamazaki Y.
        • Ogasawara K.
        • Minato N.
        • Hattori M.
        The potential role of osteopontin in the maintenance of commensal bacteria homeostasis in the intestine.
        PLoS One. 2017; 12e0173629
        • Pedraza C.E.
        • Nikolcheva L.G.
        • Kaartinen M.T.
        • Barralet J.E.
        • McKee M.D.
        Osteopontin functions as an opsonin and facilitates phagocytosis by macrophages of hydroxyapatite-coated microspheres: implications for bone wound healing.
        Bone. 2008; 43: 708-716
        • Wang H.
        • Zhou H.
        • Zhang Q.
        • Poulsen K.L.
        • Taylor V.
        • McMullen M.R.
        • Czarnecki D.
        • Dasarathy D.
        • Yu M.
        • Liao Y.
        • Allende D.S.
        • Chen X.
        • Hong L.
        • Zhao J.
        • Yang J.
        • Nagy L.E.
        • Li X.
        Inhibition of IRAK4 kinase activity improves ethanol-induced liver injury in mice.
        J Hepatol. 2020; 73: 1470-1481
        • Xiao Y.
        • Huang X.
        • Zhao Y.
        • Chen F.
        • Sun M.
        • Yang W.
        • Chen L.
        • Yao S.
        • Peniche A.
        • Dann S.M.
        • Sun J.
        • Golovko G.
        • Fofanov Y.
        • Miao Y.
        • Liu Z.
        • Chen D.
        • Cong Y.
        Interleukin-33 promotes REG3gamma expression in intestinal epithelial cells and regulates gut microbiota.
        Cell Mol Gastroenterol Hepatol. 2019; 8: 21-36
        • Liu P.
        • Wang Y.
        • Yang G.
        • Zhang Q.
        • Meng L.
        • Xin Y.
        • Jiang X.
        The role of short-chain fatty acids in intestinal barrier function, inflammation, oxidative stress, and colonic carcinogenesis.
        Pharmacol Res. 2021; 165105420
        • Jin U.H.
        • Cheng Y.
        • Park H.
        • Davidson L.A.
        • Callaway E.S.
        • Chapkin R.S.
        • Jayaraman A.
        • Asante A.
        • Allred C.
        • Weaver E.A.
        • Safe S.
        Short chain fatty acids enhance aryl hydrocarbon (Ah) responsiveness in mouse colonocytes and Caco-2 human colon cancer cells.
        Sci Rep. 2017; 710163
        • Rosser E.C.
        • Piper C.J.M.
        • Matei D.E.
        • Blair P.A.
        • Rendeiro A.F.
        • Orford M.
        • Alber D.G.
        • Krausgruber T.
        • Catalan D.
        • Klein N.
        • Manson J.J.
        • Drozdov I.
        • Bock C.
        • Wedderburn L.R.
        • Eaton S.
        • Mauri C.
        Microbiota-derived metabolites suppress arthritis by amplifying aryl-hydrocarbon receptor activation in regulatory B cells.
        Cell Metab. 2020; 31: 837-851.e10
        • Parada Venegas D.
        • De la Fuente M.K.
        • Landskron G.
        • Gonzalez M.J.
        • Quera R.
        • Dijkstra G.
        • Harmsen H.J.M.
        • Faber K.N.
        • Hermoso M.A.
        Short chain fatty acids (SCFAs)-mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases.
        Front Immunol. 2019; 10: 277
        • Liu J.
        • Yue S.
        • Yang Z.
        • Feng W.
        • Meng X.
        • Wang A.
        • Peng C.
        • Wang C.
        • Yan D.
        Oral hydroxysafflor yellow A reduces obesity in mice by modulating the gut microbiota and serum metabolism.
        Pharmacol Res. 2018; 134: 40-50
        • Cassard A.M.
        • Ciocan D.
        Microbiota, a key player in alcoholic liver disease.
        Clin Mol Hepatol. 2018; 24: 100-107
        • Llopis M.
        • Cassard A.M.
        • Wrzosek L.
        • Boschat L.
        • Bruneau A.
        • Ferrere G.
        • Puchois V.
        • Martin J.C.
        • Lepage P.
        • Le Roy T.
        • Lefevre L.
        • Langelier B.
        • Cailleux F.
        • Gonzalez-Castro A.M.
        • Rabot S.
        • Gaudin F.
        • Agostini H.
        • Prevot S.
        • Berrebi D.
        • Ciocan D.
        • Jousse C.
        • Naveau S.
        • Gerard P.
        • Perlemuter G.
        Intestinal microbiota contributes to individual susceptibility to alcoholic liver disease.
        Gut. 2016; 65: 830-839
        • Chelakkot C.
        • Ghim J.
        • Ryu S.H.
        Mechanisms regulating intestinal barrier integrity and its pathological implications.
        Exp Mol Med. 2018; 50: 1-9
        • Lin L.
        • Zhang J.
        Role of intestinal microbiota and metabolites on gut homeostasis and human diseases.
        BMC Immunol. 2017; 18: 2
        • Mukherjee S.
        • Hooper L.V.
        Antimicrobial defense of the intestine.
        Immunity. 2015; 42: 28-39
        • Zhao Y.
        • Chen F.
        • Wu W.
        • Sun M.
        • Bilotta A.J.
        • Yao S.
        • Xiao Y.
        • Huang X.
        • Eaves-Pyles T.D.
        • Golovko G.
        • Fofanov Y.
        • D'Souza W.
        • Zhao Q.
        • Liu Z.
        • Cong Y.
        GPR43 mediates microbiota metabolite SCFA regulation of antimicrobial peptide expression in intestinal epithelial cells via activation of mTOR and STAT3.
        Mucosal Immunol. 2018; 11: 752-762
        • Yu Y.
        • Yang W.
        • Bilotta A.J.
        • Yu Y.
        • Zhao X.
        • Zhou Z.
        • Yao S.
        • Xu J.
        • Zhou J.
        • Dann S.M.
        • Li Y.
        • Cong Y.
        STING controls intestinal homeostasis through promoting antimicrobial peptide expression in epithelial cells.
        FASEB J. 2020; 34: 15417-15430
        • Ulluwishewa D.
        • Anderson R.C.
        • McNabb W.C.
        • Moughan P.J.
        • Wells J.M.
        • Roy N.C.
        Regulation of tight junction permeability by intestinal bacteria and dietary components.
        J Nutr. 2011; 141: 769-776
        • Lee S.H.
        Intestinal permeability regulation by tight junction: implication on inflammatory bowel diseases.
        Intest Res. 2015; 13: 11-18
        • Gao B.
        • Duan Y.
        • Lang S.
        • Barupal D.
        • Wu T.C.
        • Valdiviez L.
        • Roberts B.
        • Choy Y.Y.
        • Shen T.
        • Byram G.
        • Zhang Y.
        • Fan S.
        • Wancewicz B.
        • Shao Y.
        • Vervier K.
        • Wang Y.
        • Zhou R.
        • Jiang L.
        • Nath S.
        • Loomba R.
        • Abraldes J.G.
        • Bataller R.
        • Tu X.M.
        • Starkel P.
        • Lawley T.D.
        • Fiehn O.
        • Schnabl B.
        Functional microbiomics reveals alterations of the gut microbiome and host co-metabolism in patients with alcoholic hepatitis.
        Hepatol Commun. 2020; 4: 1168-1182
        • Pohl K.
        • Moodley P.
        • Dhanda A.D.
        Alcohol’s impact on the gut and liver.
        Nutrients. 2021; 13: 3170
        • Gao K.
        • Mu C.L.
        • Farzi A.
        • Zhu W.Y.
        Tryptophan metabolism: a link between the gut microbiota and brain.
        Adv Nutr. 2020; 11: 709-723
        • Roager H.M.
        • Licht T.R.
        Microbial tryptophan catabolites in health and disease.
        Nat Commun. 2018; 9: 3294
        • Choi S.C.
        • Brown J.
        • Gong M.
        • Ge Y.
        • Zadeh M.
        • Li W.
        • Croker B.P.
        • Michailidis G.
        • Garrett T.J.
        • Mohamadzadeh M.
        • Morel L.
        Gut microbiota dysbiosis and altered tryptophan catabolism contribute to autoimmunity in lupus-susceptible mice.
        Sci Transl Med. 2020; 12: eaax2220
        • Trautmann A.
        • Schleicher L.
        • Deusch S.
        • Gatgens J.
        • Steuber J.
        • Seifert J.
        Short-chain fatty acids modulate metabolic pathways and membrane lipids in Prevotella bryantii B14.
        Proteomes. 2020; 8: 28
        • Ma Q.
        • Li Y.
        • Wang J.
        • Li P.
        • Duan Y.
        • Dai H.
        • An Y.
        • Cheng L.
        • Wang T.
        • Wang C.
        • Wang T.
        • Zhao B.
        Investigation of gut microbiome changes in type 1 diabetic mellitus rats based on high-throughput sequencing.
        Biomed Pharmacother. 2020; 124109873
        • Sawin E.A.
        • De Wolfe T.J.
        • Aktas B.
        • Stroup B.M.
        • Murali S.G.
        • Steele J.L.
        • Ney D.M.
        Glycomacropeptide is a prebiotic that reduces Desulfovibrio bacteria, increases cecal short-chain fatty acids, and is anti-inflammatory in mice.
        Am J Physiol Gastrointest Liver Physiol. 2015; 309: G590-G601
        • Chang S.C.
        • Shen M.H.
        • Liu C.Y.
        • Pu C.M.
        • Hu J.M.
        • Huang C.J.
        A gut butyrate-producing bacterium Butyricicoccus pullicaecorum regulates short-chain fatty acid transporter and receptor to reduce the progression of 1,2-dimethylhydrazine-associated colorectal cancer.
        Oncol Lett. 2020; 20: 327
        • Nagpal R.
        • Wang S.
        • Ahmadi S.
        • Hayes J.
        • Gagliano J.
        • Subashchandrabose S.
        • Kitzman D.W.
        • Becton T.
        • Read R.
        • Yadav H.
        Human-origin probiotic cocktail increases short-chain fatty acid production via modulation of mice and human gut microbiome.
        Sci Rep. 2018; 812649
        • Agus A.
        • Clement K.
        • Sokol H.
        Gut microbiota-derived metabolites as central regulators in metabolic disorders.
        Gut. 2021; 70: 1174-1182
        • Seo B.
        • Jeon K.
        • Moon S.
        • Lee K.
        • Kim W.K.
        • Jeong H.
        • Cha K.H.
        • Lim M.Y.
        • Kang W.
        • Kweon M.N.
        • Sung J.
        • Kim W.
        • Park J.H.
        • Ko G.
        Roseburia spp. Abundance associates with alcohol consumption in humans and its administration ameliorates alcoholic fatty liver in mice.
        Cell Host Microbe. 2020; 27: 25-40.e6
        • Ge X.
        • Antoine D.J.
        • Lu Y.
        • Arriazu E.
        • Leung T.M.
        • Klepper A.L.
        • Branch A.D.
        • Fiel M.I.
        • Nieto N.
        High mobility group box-1 (HMGB1) participates in the pathogenesis of alcoholic liver disease (ALD).
        J Biol Chem. 2014; 289: 22672-22691
        • Ge X.
        • Arriazu E.
        • Magdaleno F.
        • Antoine D.J.
        • Dela Cruz R.
        • Theise N.
        • Nieto N.
        High mobility group box-1 drives fibrosis progression signaling via the receptor for advanced glycation end products in mice.
        Hepatology. 2018; 68: 2380-2404
        • Arriazu E.
        • Ge X.
        • Leung T.M.
        • Magdaleno F.
        • Lopategi A.
        • Lu Y.
        • Kitamura N.
        • Urtasun R.
        • Theise N.
        • Antoine D.J.
        • Nieto N.
        Signalling via the osteopontin and high mobility group box-1 axis drives the fibrogenic response to liver injury.
        Gut. 2017; 66: 1123-1137
        • Cubero F.J.
        • Nieto N.
        Arachidonic acid stimulates TNFalpha production in Kupffer cells via a reactive oxygen species-pERK1/2-Egr1-dependent mechanism.
        Am J Physiol Gastrointest Liver Physiol. 2012; 303: G228-G239
        • Nieto N.
        Oxidative-stress and IL-6 mediate the fibrogenic effects of [corrected] Kupffer cells on stellate cells.
        Hepatology. 2006; 44: 1487-1501
        • Kourepini E.
        • Aggelakopoulou M.
        • Alissafi T.
        • Paschalidis N.
        • Simoes D.C.
        • Panoutsakopoulou V.
        Osteopontin expression by CD103- dendritic cells drives intestinal inflammation.
        Proc Natl Acad Sci U S A. 2014; 111: E856-E865
        • Lieber C.S.
        • DeCarli L.M.
        The feeding of alcohol in liquid diets: two decades of applications and 1982 update.
        Alcohol Clin Exp Res. 1982; 6: 523-531
        • Hubscher S.G.
        Histological assessment of non-alcoholic fatty liver disease.
        Histopathology. 2006; 49: 450-465
        • Liu Y.
        • Fan L.
        • Cheng Z.
        • Yu L.
        • Cong S.
        • Hu Y.
        • Zhu L.
        • Zhang B.
        • Cheng Y.
        • Zhao P.
        • Zhao X.
        • Cheng M.
        Fecal transplantation alleviates acute liver injury in mice through regulating Treg/Th17 cytokines balance.
        Sci Rep. 2021; 11: 1611
        • Das S.
        • Ge X.
        • Han H.
        • Desert R.
        • Song Z.
        • Athavale D.
        • Chen W.
        • Gaskell H.
        • Lantvit D.
        • Guzman G.
        • Nieto N.
        The integrated “multiomics” landscape at peak injury and resolution from alcohol-associated liver disease.
        Hepatol Commun. 2022; 6: 133-160
        • Caporaso J.G.
        • Lauber C.L.
        • Walters W.A.
        • Berg-Lyons D.
        • Huntley J.
        • Fierer N.
        • Owens S.M.
        • Betley J.
        • Fraser L.
        • Bauer M.
        • Gormley N.
        • Gilbert J.A.
        • Smith G.
        • Knight R.
        Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.
        ISME J. 2012; 6: 1621-1624
        • Caporaso J.G.
        • Lauber C.L.
        • Walters W.A.
        • Berg-Lyons D.
        • Lozupone C.A.
        • Turnbaugh P.J.
        • Fierer N.
        • Knight R.
        Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.
        Proc Natl Acad Sci U S A. 2011; 108: 4516-4522
        • Zeineldin M.
        • Neufeld K.
        Isolation of epithelial cells from mouse gastrointestinal tract for WesTERN Blot or RNA analysis.
        Bio Protoc. 2012; 2: e292