Advertisement
Research Letter| Volume 7, ISSUE 3, P689-691.e4, 2019

Muscularis Propria Macrophages Alter the Proportion of Nitrergic but Not Cholinergic Gastric Myenteric Neurons

Open AccessPublished:January 31, 2019DOI:https://doi.org/10.1016/j.jcmgh.2019.01.005

      Abbreviations used in this letter:

      BMP2 (bone morphogenetic protein 2), ChAT+ (choline acetyltransferase+), CSF1 (Colony stimulating factor 1), HuC/D (embryonic lethal, abnormal vision, Drosophila-like protein 3/4 antigen), MPM (muscularis propria macrophage), NA (numerical aperture), NOS (nitric oxide synthase), WT (wild-type)
      The enteric nervous system consists of more than a dozen types of neurons aggregated into networks of ganglia throughout the gastrointestinal tract, which regulate contractile activity, mucosal secretion, absorption, and local blood flow.
      • Furness J.B.
      • Furness J.B.
      Mechanisms that contribute to remodeling of the enteric neuronal networks are of great interest. In the central nervous system, it has been suggested that microglia contribute to the fate, connectivity, and identity of neurons during development.
      • Tremblay M.E.
      • et al.
      Muscularis propria macrophages (MPM) within the enteric nervous system may have similar functions to microglia. Mice homozygous for the osteopetrosis mutation (Csf1op/op) which do not have MPM, have more neurons in the small intestine
      • Muller P.A.
      • et al.
      and a higher proportion of gastric neurons that express nitric oxide synthase (NOS1).
      • Cipriani G.
      • et al.
      Myenteric neurons serve diverse functions that can be indicated by their morphology, projections and the expression of marker proteins that define their “chemical code.” This study finds a previously unidentified role for MPM in altering the chemical code of myenteric neurons.
      Csf1op/op mice were maintained on a specialized liquid diet to keep their weight comparable with age-matched-wild type (WT) mice (Supplementary Figure 1A). In the myenteric plexus of WT mice, populations of MPM, absent in Csf1op/op mice
      • Cipriani G.
      • et al.
      (Supplementary Figure 1B and C, Supplementary Movie 1 and 2), were associated closely with neurons, suggesting functional interactions.
      • Gabanyi I.
      • et al.
      We first tested whether the number of choline acetyltransferase+ (ChAT+) neurons was affected by the absence of MPM in Csf1op/op mice (Supplementary Table 1). The density of neurons, defined by Embryonic lethal, abnormal vision, Drosophila-like protein 3/4 (HuC/D) immunoreactivity, was similar between gastric regions in both WT and Csf1op/op mice (Figure 1A–C, Supplementary Figure 2A) (Mann–Whitney test, P = NS; N = 4), yet was higher in Csf1op/op mice than in WT mice (Figure 1D and E) (P < .01, Mann–Whitney test, n = 36 fields, N = 4). Likewise, the density of ChAT+ neurons was higher in Csf1op/op mice compared with WT mice (Figure 1D and E) (P < .001, Mann–Whitney test, n = 36 fields, N = 4). However, in contrast to an increase in the percentage of NOS1+ neurons,
      • Cipriani G.
      • et al.
      the percentage of ChAT+ neurons did not differ between Csf1op/op and WT mice (Figure 1D and E) (Mann–Whitney test, n = 36 fields, N = 4). This result suggests that the presence of macrophages alters the proportion of nitrergic but not cholinergic gastric myenteric neurons.
      Figure thumbnail gr1
      Figure 1(A) Distribution of HuC/D+ and ChAT+ myenteric neurons across gastric regions. Scale bar: 200 μm. (B) Images of HuC/D+ and ChAT+ neurons in the gastric regions of Csf1op/op mice. Scale bar: 50 μm. (C) Quantification of HuC/D+ and ChAT+ neurons in the gastric regions of Csf1op/op mice (Mann–Whitney test; P = NS). (D) Images of gastric HuC/D+ and ChAT+ neurons in WT and Csf1op/op mice. Scale bar: 60 μm. Arrow indicates typical HuC/D+ and ChAT+ co-expressing neurons. (E) Quantification of HuC/D+ and ChAT+ neurons in WT and Csf1op/op mice (n = 36 fields; N = 4 mice) (Mann–Whitney test; P < .01). (C and E) Bars and whiskers indicate means ± SD and points indicate individual fields for all panels.
      Interestingly, in Csf1op/op mice, the combined percentages of NOS1+ (30%) and ChAT+ neurons (72%) exceeded 100% (Supplementary Figure 2B), indicating partial overlap between these markers. Therefore, we investigated whether the number of NOS1+ChAT+ double-labeled neurons was changed in Csf1op/op mice. In Csf1op/op mice, Nitric Oxide Synthase 1 (NOS1+) ChAT+ neurons were more numerous than in WT mice (Figure 2A and B) (Csf1op/op: 7.8 ± 7.1 cells/field; WT, 1.7 ± 1.6 cells/field; 1-way analysis of variance; P < .001; n = 24; N = 4). This result suggests the ability of macrophages to not only modulate the neuronal number but also affect myenteric neuron differentiation. Enteric neurons are not required for bowel colonization by macrophages,
      • Avetisyan M.
      • et al.
      but macrophages interact with neurons after birth, by expressing genes, such as bone morphogenetic protein 2 (BMP2), needed for macrophage-enteric neuron interaction and neuronal development.
      • Muller P.A.
      • et al.
      To test the intrinsic ability of resident macrophages to modify the neuronal chemical code by establishing functional interaction with neurons, we treated Csf1op/op with CSF1 (Colony Stimulating Factor 1) for 7 weeks to populate the stomach with macrophages (Figure 2C). In CSF1-treated Csf1op/op mice, the proportion of NOS1+ChAT+ neurons remained similar to the proportion of NOS1+ChAT+ neurons in Csf1op/op mice (Figure 2A–C) (1-way analysis of variance; n = 24; N = 4). We previously showed that repopulating macrophages in CSF1-treated Csf1op/op mice had a different phenotype from resident macrophages.
      • Cipriani G.
      • et al.
      Consistent with this observation, BMP2 was not expressed by macrophages isolated from CSF1-treated Csf1op/op mice (Antibodies and PCR primers listed in Supplementary Tables 2 and 3), whereas BMP2 was expressed by macrophages isolated from WT mice (Figure 2D and E) (Mann–Whitney test; P < .001; N = 4), as reported elsewhere.
      • Muller P.A.
      • et al.
      Figure thumbnail gr2
      Figure 2(A) Images of NOS1+/ChAT+ neurons. Scale bar: 50 μm. Arrows show NOS1+ neurons that are also ChAT+. (B) Quantification of NOS1+ChAT+ double-labeled neurons. Points represent individual fields of view. Bars and whiskers indicate means ± SD (1-way analysis of variance; P < .01; N = 4). (C) Experimental model for CSF1 treatment. Fluorescence-activated cell sorter (FACS) strategy to isolate CD45+CD11b+F4/80+ macrophages from the gastric muscularis propria of WT (top) and CSF1-treated Csf1op/op mice (bottom). (E) BMP2 expression levels in macrophages isolated from Csf1op/op and WT mice (Mann–Whitney test; N = 3; P < .01).
      During development, the chemical code of myenteric neurons changes and the overlap between NOS1 and ChAT decreases as neurons mature.
      • Hao M.M.
      • et al.
      Therefore, increased numbers of double-labeled myenteric neurons may reflect incomplete maturation of myenteric neurons in Csf1op/op mice. MPMs functionally interact with enteric neurons starting at 2 weeks of age,
      • Avetisyan M.
      • et al.
      therefore the role of resident MPM in promoting myenteric neuron maturation likely happens early in life. Interestingly, MPMs that populate the gastric muscularis propria did not express BMP2, a cytokine important for establishing functional interactions between MPMs and neurons during development. Therefore, as previously suggested,
      • Muller P.A.
      • et al.
      • Anitha M.
      • et al.
      BMP2 may be required for the changes in NOS1 and ChAT expression associated with neuronal maturation.
      Taken together, our results show a role for MPM in enteric neuronal maturation as indicated by the changes in chemical code in gastric myenteric neurons. The mechanisms by which MPM regulate neuronal numbers and chemical codes needs further investigation because it may be significant to the development or plasticity of the adult enteric nervous system and normal gastric function.

      Acknowledgments

      The authors thank Mrs Kristy Zodrow for her excellent assistance with this work; the Mayo Microscopy and Cell Analysis Core for assistance with the flow cytometry experiment; and Dr Vanda Lennon (Mayo Clinic) for supplying the HuC/D antibody used for the immunohistochemistry study.

      Supplementary Materials and Methods

      Animals

      These studies were approved by the Mayo Clinic Institutional Animal Care and Use Committee. Mice were humanely killed by carbon dioxide exposure followed by cervical dislocation. Mice homozygous for the Csf1op mutation and WT littermates were studied. These mice were bred in-house from a Csf1op/+ colony of hemizygous breeders with founders originating from The Jackson Laboratory (Bar Harbor, ME). Wild-type Csf1+/+ mice were identified by genotyping as previously described.
      • Furness J.B.
      Csf1op/op mice were maintained on a specialized wet diet (Bio-serv, Frenchtown, NJ) after weaning at 3–4 weeks of age to keep their weight comparable with age-matched WT mice (Supplementary Figure 1A). After 12 weeks of age, Csf1op/op mice were treated with CSF1 (2.5 μg intraperitoneally once daily, recombinant mouse macrophage colony stimulating factor-1 (rmM-CSF); Peprotech, Rocky Hill, NJ) (Figure 2A).

      Immunolabeling

      The mucosa was removed and muscularis propria was fixed with 4% paraformaldehyde in 0.1 mol/L phosphate buffer for 4 hours. Then, whole mounts were rinsed in 0.1 mol/L phosphate-buffered saline and blocked in the presence of 10% normal donkey serum in phosphate-buffered saline and 0.3% Triton X-100 (Thermo Fisher, Waltham, MA) overnight at 4°C and gastric muscularis propria was labeled with primary antibodies overnight at 4°C. After washing, the tissue was incubated with secondary antibodies (Jackson ImmunoResearch, West Grove, PA), washed, and then incubated with 4',6-diamidino-2-phenylindole dilactate (Invitrogen, Carlsbad, CA) for 30 minutes. Neurons were identified by HuC/D-immunoreactivity (ANNA1, a gift from Dr Vanda Lennon, Mayo Clinic, Rochester, MN), cholinergic neurons using a goat anti-ChAT antibody (EMD Millipore, Burlington, MA), and nitrergic neurons using a rabbit anti-NOS1 antibody (EMD Millipore). Muscularis macrophages were identified using the MHCII primary antibody (eBioscience, Waltham, MA).
      Controls omitting the primary antibody and controls in double-labeling experiments that used the wrong secondary antibody were performed for all experiments. For quantification, 3 different fields were taken from the corpus and 3 from the antrum. The list of antibodies is shown in Supplementary Table 1.

      Confocal Microscopy

      A laser scanning confocal microscope using a 20×, numerical aperture, (NA), 0.95 XLUMPlanFl objective (Olympus, Tokyo, Japan) in Fluoview (Olympus), with the optimal confocal aperture to provide a resolution of 0.994 × 0.994 × 1.13 μm (X × Y × Z), was used. Stacks of confocal images of the entire muscularis propria were collected from 4 different mice (n = 4). For quantification of the labeling, all of the confocal image stacks were flattened into projections using the FV10-ASW Viewer (Olympus). The flattened images were renumbered in random order and the enteric neuronal number was determined while blinded to the source. All cells were counted from fields with dimensions of 636 × 636 μm.
      Images used for reconstruction and orthogonal view were taken from a Zeiss LSM 780 microscope using either a 40× 1.2 NA water immersion objective at a resolution of 0.415 × 0.415 × 0.444, or a 100 × 1.4 NA oil immersion objective at a resolution of 0.133 × 0.133 × 0.373 μm per pixel. Images were analyzed using Imaris-Microscopy Image Software by Bitplane (Supplementary Figure 1A).

      Isolation and Analysis of Gastric Muscularis Macrophages

      Cell sorting was performed using a fluorescence activated cell sorting Aria Cell Sorter cytometer running fluorescence activated cell sorting Diva 6 software (Becton Dickinson, San Jose, CA), located in the Mayo Clinic Flow Cytometry Core Facility. Aliquots of cells were either unstained or stained with individual fluorescently labeled antibodies (Zurich, Switzerland, Supplementary Table 2) to establish instrument voltages, compensation, and appropriate gates. Each positive control tube was initially run without storing the data to ensure that the positive signals were on scale. Data were analyzed using FlowJo X software (Tree Star, Inc, Ashland, OR).
      Gastric CD45+CD11b+F4/80+ cells were isolated directly into the lysing buffer provided by the RNeasy micro plus kit (Qiagen, Hilden, Germany). The extraction was performed following the instructions provided and the RNA concentration was determined by using a NanoDrop spectrophotometer. The RNA extracted was used for a real-time quantitative reverse-transcription polymerase chain reaction. The SuperScript VILO complementary DNA Synthesis Kit (Invitrogen) was used to generate complementary DNA. Quantitative reverse-transcription polymerase chain reaction was performed on complementary DNA using commercial primer sets (Supplementary Table 3) and RT2SYBR Green/ROX quantitative reverse-transcription polymerase chain reaction master mix according to the manufacturer's instructions (SABiosciences, Frederick, MD). The data were normalized to the expression of the glyceraldehyde-3-phosphate dehydrogenase by transforming the difference in threshold cycle for the gene of interest and the housekeeping gene to the second power, and expressed as the means ± SEM.

      Statistics

      Data are expressed as scatter plots with medians and quartiles and analyzed by the Mann–Whitney test. A P value less than .05 was considered significant. The method used for statistical analysis of 3 different groups was 1-way analysis of variance with multiple comparisons. Normality was addressed by applying D’Agostino and Pearson normality tests. Statistical analysis was performed with GraphPad Prism (GraphPad Software, La Jolla, CA).
      Figure thumbnail fx1
      Supplementary Figure 1(A) Weight of WT and CSf1op/op mice (P = NS; Mann–Whitney test; N = 7 mice for each group). (B and C) Major histocompatibility complex class II (MHCII) macrophages (green) and Protein gene product 9.5 (PGP 9.5) fibers in smooth muscular layers (upper panels) and myenteric plexus (lower panels). The small panels show orthogonal views generated by projecting the z-series in the x (right) and on the y plane (above). Arrows point to macrophage/fiber interactions and squares show macrophage/fiber interactions in orthogonal views. PGP 9.5 immunoreactivity was unusually bright in the cell bodies of myenteric neurons in CSf1op/op mice when compared with WT tissues. Scale bars: (B) 20 μm, (C) 10 μm.
      Figure thumbnail fx2
      Supplementary Figure 2(A) Quantification of the HuC/D+ myenteric neurons in the gastric corpus and antrum of WT and Csf1op/op mice. (B) Percentage of myenteric neurons identified in Csf1op/op and WT mice. Table shows numbers per field and proportions of different types of myenteric neurons in Csf1op/op and WT mice.
      Supplementary Table 1Sources of Commercial Antibodies Used in Immunohistochemistry Experiments
      SupplierFinal titerHostClonalityCatalog numberResearch resource initiative identifier
      Primary antibody
       Embryonic lethal, abnormal vision, Drosophila-like protein 3/4Gift from Dr V. Lennon (Mayo Clinic)1:500HumanAB_2314657
       NOS1Millipore0.33 μg/mLRabbitPolyclonalAB5380AB_91824
       ChATMillipore1:100GoatPolyclonalAB144PAB_2079751
       F4/80 direct conjugateThermo Fisher0.4 μg/mLRatPolyclonalMF 48020AB_10376287
       Major Histocompatibility Complex IIeBioscience1.0 μg/mLRatMonoclonal14-5321-81AB_467560
       Protein Gene Product 9.5Thermo Fisher1:400RabbitPolyclonal38-1000AB_2533355
      Secondary antibody
       Cy3 anti-goatJackson ImmunoResearch1.75 μg/mLDonkeyPolyclonal705-165-147AB_2307351
       Alexa Fluor–488 anti-ratJackson ImmunoResearch2.33 μg/mLDonkeyPolyclonal712-545-150AB_2340683
       Cy3 anti-rabbitJackson ImmunoResearch1.75 μg/mLDonkeyPolyclonal711-165-152AB_2307443
       Cy5 anti-humanJackson ImmunoResearch1.75 μg/mLDonkeyPolyclonal709-175-149AB_2340539
      Supplementary Table 2List of Antibodies Used for Sorting Experiments and List of Primers Used for Quantitative Reverse-Transcription Polymerase Chain Reaction
      AntibodyFluorophoreCatalog numberCompany
      F4/80 monoclonal antibody (BM8)Phycoerythrin--cyanine 515-4801-82eBioscence
      Anti-mouse CD11bAlexa Fluor 48853-0112-82eBioscence
      Anti-mouse CD45Alexa Fluor 45048-0451-82eBioscence
      Rat IgG2b K isotype controlAPC17-4031-81eBioscence
      Rat IgG2a K isotype controlPE-cyanine 725-4321-81eBioscence
      Supplementary Table 3List of Primers used for RT-PCR
      Gene symbolUnigene titleForwardReverse
      BMP2Bone morphogenetic protein 2GGTGATGGCTTCCTTGTACCAGTGAGGCCCATACCAGAAG
      GapdhGlyceraldehyde-3-phosphate dehydrogenaseQiagenQiagen

      Supplementary Material

      References

        • Furness J.B.
        J Auton Nerv Syst. 2000; 81: 87-96
        • Furness J.B.
        Nat Rev Gastroenterol Hepatol. 2012; 9: 286-294
        • Tremblay M.E.
        • et al.
        J Neurosci. 2011; 31: 16064-16069
        • Muller P.A.
        • et al.
        Cell. 2014; 158: 300-313
        • Cipriani G.
        • et al.
        Gastroenterology. 2018; 154: 2122-2136 e12
        • Gabanyi I.
        • et al.
        Cell. 2016; 164: 378-391
        • Avetisyan M.
        • et al.
        Proc Natl Acad Sci U S A. 2018; 115: 4696-4701
        • Hao M.M.
        • et al.
        J Comp Neurol. 2013; 521: 3358-3370
        • Anitha M.
        • et al.
        Am J Physiol Gastrointest Liver Physiol. 2010; 298: G375-G383